\documentclass{article}
\usepackage{geometry}
\usepackage{graphicx}
\usepackage{cite}

\geometry{a4paper, margin=1in}


\usepackage[
    sortcites,
    backend=biber,
    hyperref=true,
    firstinits=true,
    maxbibnames=99,
    ]{biblatex}
\addbibresource{references.bib}

\title{BLAST Analysis Report}
\author{}
\date{}

\begin{document}

\maketitle

\section*{Introduction}
This report presents the results of a BLAST analysis for a DNA sequence of sample 2, which was compared against the NCBI nucleotide database. The aim of the analysis was to identify the closest matching species for the sample.

\section*{Background}
\textit{Fusarium solani} is a filamentous fungus commonly found in soil and known to cause infections in plants, animals, and humans. It is a significant pathogen, especially in immunocompromised individuals, leading to infections such as keratitis and onychomycosis \cite{solani_infections,solani_keratitis}. This species is also associated with various agricultural diseases, affecting crops like peas and beans \cite{solani_agriculture}.

Molecular identification methods, such as BLAST, have been essential in distinguishing \textit{F. solani} from other related fungi, due to its genetic variability and morphological similarity to other Fusarium species \cite{fusarium_genetics}. This analysis aims to provide further insight into the specific strain associated with the given sample.

\section*{Primer Characteristics}

For the amplification of the ITS region, the following primers were used:

\begin{itemize}
    \item \textbf{ITS1 Primer:} The ITS1 primer has the sequence \texttt{TCCGTAGGTGAACCTGCGG} and is designed to bind to the conserved region at the start of the ITS1 region. This primer is specific for fungi and is widely used in molecular studies for identifying fungal species \cite{white1990amplification}.
    \item \textbf{ITS4 Primer:} The ITS4 primer has the sequence \texttt{TCCTCCGCTTATTGATATGC} and binds at the end of the ITS2 region. Together with ITS1, it allows for the amplification of the entire ITS region, including both ITS1 and ITS2, as well as the 5.8S rRNA gene.
\end{itemize}

\textbf{Purpose of ITS Primers:} The ITS (Internal Transcribed Spacer) region, located between the small subunit (SSU) and large subunit (LSU) rRNA genes, is highly variable among different fungal species, making it an ideal target for molecular identification. The ITS1 and ITS4 primers are commonly used to amplify this region for taxonomic and phylogenetic studies \cite{white1990amplification}.

\textbf{Applications:} The amplified ITS region serves as a "barcode" for identifying fungal species and is used in environmental sequencing, clinical diagnostics, and biodiversity studies. The amplified sequences can then be compared against databases, such as GenBank, to identify the fungal species present in the sample.

\section*{Key Results}
The BLAST search identified multiple high-confidence matches for the sequence, with the closest matches aligning to various isolates of \textit{Fusarium solani}. The following are the key details:

\begin{itemize}
    \item \textbf{Closest Species Match:} \textit{Fusarium solani}
    \item \textbf{Top E-value:} $1.59328 \times 10^{-53}$
    \item \textbf{Top Alignment Score:} 244.0
    \item \textbf{Sequence Identity:} 122 out of 122 nucleotides (100\% identity)
\end{itemize}

\section*{Detailed BLAST Hits}
The table below summarizes the top hits from the BLAST analysis, showing the sequence alignment scores, E-values, and identities.

\begin{center}
\begin{tabular}{|l|l|c|c|c|}
\hline
\textbf{GenBank ID} & \textbf{Organism} & \textbf{Length (bp)} & \textbf{Score} & \textbf{E-value} \\
\hline
gi|217314860 & \textit{Fusarium solani} isolate T03 & 568 & 244.0 & $1.59328 \times 10^{-53}$ \\
gi|2813891763 & \textit{Fusarium solani} isolate Fso2 & 561 & 244.0 & $1.59328 \times 10^{-53}$ \\
gi|599088294 & Uncultured \textit{Fusarium} clone TTRK-10 & 567 & 244.0 & $1.59328 \times 10^{-53}$ \\
gi|2813891767 & \textit{Fusarium solani} isolate Fso6 & 567 & 244.0 & $1.59328 \times 10^{-53}$ \\
gi|2187833333 & \textit{Fusarium solani} isolate CBG103 & 563 & 239.0 & $6.77482 \times 10^{-52}$ \\
\hline
\end{tabular}
\end{center}

\section*{Summary}
The analysis strongly suggests that the DNA sequence in sample 2 is derived from a strain of \textit{Fusarium solani}, with several high-confidence hits indicating identical or nearly identical sequences. Given the low E-values and high sequence identity, \textit{Fusarium solani} is the most likely source organism for this sample.

\newpage
\printbibliography

\end{document}