rev 0.01
This commit is contained in:
email
parent
0bf9fa9bd8
commit
cb1d872eed
|
|
@ -0,0 +1,146 @@
|
|||
from Bio import Entrez, SeqIO, SearchIO
|
||||
from Bio.Blast import NCBIWWW, NCBIXML
|
||||
import os
|
||||
import statistics
|
||||
import time
|
||||
|
||||
# Ustawienie adresu e-mail dla API NCBI
|
||||
Entrez.email = "baiobelfer@gmail.com"
|
||||
|
||||
# Ścieżki do plików
|
||||
data_dir = "data"
|
||||
log_dir = "_log"
|
||||
out_dir = "out"
|
||||
os.makedirs(log_dir, exist_ok=True)
|
||||
os.makedirs(out_dir, exist_ok=True)
|
||||
|
||||
# Ścieżki do plików primerów i sekwencji
|
||||
primer_ITS1_file = os.path.join(data_dir, "ITS1.fasta")
|
||||
primer_ITS4_file = os.path.join(data_dir, "ITS4.fasta")
|
||||
sequence_file = os.path.join(data_dir, "sequence.fasta")
|
||||
|
||||
# Ścieżka do pliku BLAST
|
||||
blast_results_file = os.path.join(data_dir, "blast_results.xml")
|
||||
|
||||
# Funkcja do wczytywania primerów z plików FASTA
|
||||
def load_primer(primer_file):
|
||||
record = SeqIO.read(primer_file, "fasta")
|
||||
return str(record.seq)
|
||||
|
||||
# Funkcja do wyszukiwania miejsc dopasowania primerów w sekwencji genomu
|
||||
def find_primer_sites(genome_seq, primer_seq):
|
||||
sites = []
|
||||
primer_len = len(primer_seq)
|
||||
for i in range(len(genome_seq) - primer_len + 1):
|
||||
if genome_seq[i:i + primer_len] == primer_seq:
|
||||
sites.append(i)
|
||||
return sites
|
||||
|
||||
# Funkcja do analizy amplifikowanych regionów
|
||||
def analyze_amplification(sequence_file, primer_its1, primer_its4, log_path):
|
||||
amplification_stats = []
|
||||
amplified_sequences = []
|
||||
|
||||
# Otwieranie pliku logowania
|
||||
with open(log_path, "w") as log_file:
|
||||
log_file.write("Amplified Regions:\n")
|
||||
|
||||
# Wczytanie genomu
|
||||
genome = SeqIO.read(sequence_file, "fasta")
|
||||
genome_seq = str(genome.seq)
|
||||
|
||||
# Wyszukiwanie dopasowań primerów
|
||||
its1_sites = find_primer_sites(genome_seq, primer_its1)
|
||||
its4_sites = find_primer_sites(genome_seq, primer_its4)
|
||||
|
||||
# Analiza amplifikacji między ITS1 i ITS4
|
||||
for start in its1_sites:
|
||||
for end in its4_sites:
|
||||
if end > start:
|
||||
amplified_region = genome_seq[start:end + len(primer_its4)]
|
||||
amplified_len = len(amplified_region)
|
||||
amplification_stats.append(amplified_len)
|
||||
amplified_sequences.append(amplified_region)
|
||||
log_file.write(f"Position {start}-{end + len(primer_its4)} | Length: {amplified_len} bp\n")
|
||||
break
|
||||
|
||||
# Analiza statystyczna długości amplifikowanych regionów
|
||||
if amplification_stats:
|
||||
avg_length = statistics.mean(amplification_stats)
|
||||
median_length = statistics.median(amplification_stats)
|
||||
min_length = min(amplification_stats)
|
||||
max_length = max(amplification_stats)
|
||||
|
||||
log_file.write("\nAmplification Statistics:\n")
|
||||
log_file.write(f"Average Length: {avg_length} bp\n")
|
||||
log_file.write(f"Median Length: {median_length} bp\n")
|
||||
log_file.write(f"Min Length: {min_length} bp\n")
|
||||
log_file.write(f"Max Length: {max_length} bp\n")
|
||||
else:
|
||||
log_file.write("No amplification regions found.\n")
|
||||
|
||||
return amplified_sequences
|
||||
|
||||
# Funkcja do wysyłania zapytania BLAST do NCBI
|
||||
def perform_blast(sequences, blast_output_file):
|
||||
# Łączenie wszystkich amplifikowanych sekwencji w jedno zapytanie
|
||||
query_sequence = "\n".join(sequences)
|
||||
|
||||
# Wysyłanie zapytania BLAST
|
||||
print("Wysyłanie zapytania BLAST do NCBI...")
|
||||
result_handle = NCBIWWW.qblast("blastn", "nt", query_sequence)
|
||||
|
||||
# Zapisywanie wyników BLAST do pliku
|
||||
with open(blast_output_file, "w") as out_handle:
|
||||
out_handle.write(result_handle.read())
|
||||
result_handle.close()
|
||||
print(f"Wyniki BLAST zapisane do pliku {blast_output_file}")
|
||||
|
||||
# Funkcja do analizy wyników BLAST
|
||||
def analyze_blast(blast_output_file, analysis_log_path):
|
||||
print("Analiza wyników BLAST...")
|
||||
with open(blast_output_file) as result_handle, open(analysis_log_path, "w") as log_file:
|
||||
blast_records = NCBIXML.parse(result_handle)
|
||||
for record in blast_records:
|
||||
for alignment in record.alignments:
|
||||
for hsp in alignment.hsps:
|
||||
log_file.write("****HIT****\n")
|
||||
log_file.write(f"Sequence: {alignment.hit_def}\n")
|
||||
log_file.write(f"Length: {hsp.align_length}\n")
|
||||
log_file.write(f"E-value: {hsp.expect}\n")
|
||||
log_file.write(f"Score: {hsp.score}\n")
|
||||
log_file.write(f"Identities: {hsp.identities}/{hsp.align_length}\n")
|
||||
log_file.write("Query sequence:\n")
|
||||
log_file.write(f"{hsp.query}\n")
|
||||
log_file.write("Match:\n")
|
||||
log_file.write(f"{hsp.match}\n")
|
||||
log_file.write("Subject sequence:\n")
|
||||
log_file.write(f"{hsp.sbjct}\n\n")
|
||||
print(f"Analiza BLAST zakończona. Wyniki zapisane do {analysis_log_path}")
|
||||
|
||||
def main():
|
||||
# Wczytywanie primerów
|
||||
primer_ITS1 = load_primer(primer_ITS1_file)
|
||||
primer_ITS4 = load_primer(primer_ITS4_file)
|
||||
|
||||
# Analiza amplifikacji i zapis logów
|
||||
log_path = os.path.join(log_dir, "amplification_analysis_log.txt")
|
||||
amplified_sequences = analyze_amplification(sequence_file, primer_ITS1, primer_ITS4, log_path)
|
||||
|
||||
print(f"Amplification analysis completed. Results saved to {log_path}")
|
||||
|
||||
if amplified_sequences:
|
||||
# Wykonanie BLAST dla amplifikowanych regionów
|
||||
perform_blast(amplified_sequences, blast_results_file)
|
||||
|
||||
# Analiza wyników BLAST
|
||||
blast_analysis_log = os.path.join(log_dir, "blast_analysis_log.txt")
|
||||
analyze_blast(blast_results_file, blast_analysis_log)
|
||||
|
||||
print(f"BLAST analysis completed. Results saved to {blast_analysis_log}")
|
||||
else:
|
||||
print("Brak amplifikowanych regionów do analizy BLAST.")
|
||||
|
||||
if __name__ == "__main__":
|
||||
main()
|
||||
|
||||
|
|
@ -0,0 +1,49 @@
|
|||
from Bio.Blast import NCBIWWW, NCBIXML
|
||||
from Bio import SeqIO
|
||||
import os
|
||||
|
||||
# Ścieżka do pliku FASTA z sekwencją
|
||||
fasta_file = "../data/sequence.fasta"
|
||||
|
||||
# Sprawdzenie, czy plik FASTA istnieje
|
||||
if not os.path.exists(fasta_file):
|
||||
print("Plik FASTA nie istnieje. Upewnij się, że plik sequence.fasta znajduje się w katalogu data.")
|
||||
exit(1)
|
||||
|
||||
# Odczytywanie sekwencji z pliku FASTA
|
||||
record = SeqIO.read(fasta_file, format="fasta")
|
||||
sequence = str(record.seq)
|
||||
|
||||
# Wykonanie zapytania BLAST
|
||||
print("Wysyłanie zapytania BLAST do NCBI...")
|
||||
result_handle = NCBIWWW.qblast("blastn", "nt", sequence)
|
||||
|
||||
# Zapis wyników BLAST do pliku XML
|
||||
output_file = "../data/blast_results.xml"
|
||||
with open(output_file, "w") as out_handle:
|
||||
out_handle.write(result_handle.read())
|
||||
|
||||
print(f"Wyniki BLAST zapisane do pliku {output_file}")
|
||||
|
||||
# Parsowanie wyników z pliku XML i wyświetlenie wyników
|
||||
print("Analiza wyników BLAST...")
|
||||
with open(output_file) as result_handle:
|
||||
blast_records = NCBIXML.parse(result_handle)
|
||||
|
||||
for blast_record in blast_records:
|
||||
for alignment in blast_record.alignments:
|
||||
for hsp in alignment.hsps:
|
||||
if hsp.expect < 0.01: # wartość e-value
|
||||
print("\n****HIT****")
|
||||
print(f"Sequence: {alignment.title}")
|
||||
print(f"Length: {alignment.length}")
|
||||
print(f"E-value: {hsp.expect}")
|
||||
print(f"Score: {hsp.score}")
|
||||
print(f"Identities: {hsp.identities}/{hsp.align_length}")
|
||||
print("Query sequence:")
|
||||
print(hsp.query[0:75] + "...")
|
||||
print("Match:")
|
||||
print(hsp.match[0:75] + "...")
|
||||
print("Subject sequence:")
|
||||
print(hsp.sbjct[0:75] + "...")
|
||||
|
||||
|
|
@ -0,0 +1,21 @@
|
|||
from Bio.Seq import Seq
|
||||
from Bio.SeqRecord import SeqRecord
|
||||
from Bio import SeqIO
|
||||
|
||||
# Sekwencje starterów
|
||||
primer_ITS1 = "TCCGTAGGTGAACCTGCGG"
|
||||
primer_ITS4 = "TCCTCCGCTTATTGATATGC"
|
||||
|
||||
# Tworzenie obiektów SeqRecord dla starterów
|
||||
its1_record = SeqRecord(Seq(primer_ITS1), id="ITS1", description="ITS1 primer sequence")
|
||||
its4_record = SeqRecord(Seq(primer_ITS4), id="ITS4", description="ITS4 primer sequence")
|
||||
|
||||
# Zapis do plików FASTA w katalogu ../data
|
||||
with open("../data/ITS1.fasta", "w") as its1_file:
|
||||
SeqIO.write(its1_record, its1_file, "fasta")
|
||||
|
||||
with open("../data/ITS4.fasta", "w") as its4_file:
|
||||
SeqIO.write(its4_record, its4_file, "fasta")
|
||||
|
||||
print("Sekwencje starterów zapisano do plików ../data/ITS1.fasta i ../data/ITS4.fasta.")
|
||||
|
||||
|
|
@ -0,0 +1,2 @@
|
|||
>ITS1 primer sequence
|
||||
TCCGTAGGTGAACCTGCGG
|
||||
|
|
@ -0,0 +1,2 @@
|
|||
>ITS4 primer sequence
|
||||
TCCTCCGCTTATTGATATGC
|
||||
File diff suppressed because it is too large
Load Diff
Binary file not shown.
82
doc/main.tex
82
doc/main.tex
|
|
@ -0,0 +1,82 @@
|
|||
\documentclass{article}
|
||||
\usepackage{geometry}
|
||||
\usepackage{graphicx}
|
||||
\usepackage{cite}
|
||||
|
||||
\geometry{a4paper, margin=1in}
|
||||
|
||||
|
||||
\usepackage[
|
||||
sortcites,
|
||||
backend=biber,
|
||||
hyperref=true,
|
||||
firstinits=true,
|
||||
maxbibnames=99,
|
||||
]{biblatex}
|
||||
\addbibresource{references.bib}
|
||||
|
||||
\title{BLAST Analysis Report}
|
||||
\author{}
|
||||
\date{}
|
||||
|
||||
\begin{document}
|
||||
|
||||
\maketitle
|
||||
|
||||
\section*{Introduction}
|
||||
This report presents the results of a BLAST analysis for a DNA sequence of sample 2, which was compared against the NCBI nucleotide database. The aim of the analysis was to identify the closest matching species for the sample.
|
||||
|
||||
\section*{Background}
|
||||
\textit{Fusarium solani} is a filamentous fungus commonly found in soil and known to cause infections in plants, animals, and humans. It is a significant pathogen, especially in immunocompromised individuals, leading to infections such as keratitis and onychomycosis \cite{solani_infections,solani_keratitis}. This species is also associated with various agricultural diseases, affecting crops like peas and beans \cite{solani_agriculture}.
|
||||
|
||||
Molecular identification methods, such as BLAST, have been essential in distinguishing \textit{F. solani} from other related fungi, due to its genetic variability and morphological similarity to other Fusarium species \cite{fusarium_genetics}. This analysis aims to provide further insight into the specific strain associated with the given sample.
|
||||
|
||||
\section*{Primer Characteristics}
|
||||
|
||||
For the amplification of the ITS region, the following primers were used:
|
||||
|
||||
\begin{itemize}
|
||||
\item \textbf{ITS1 Primer:} The ITS1 primer has the sequence \texttt{TCCGTAGGTGAACCTGCGG} and is designed to bind to the conserved region at the start of the ITS1 region. This primer is specific for fungi and is widely used in molecular studies for identifying fungal species \cite{white1990amplification}.
|
||||
\item \textbf{ITS4 Primer:} The ITS4 primer has the sequence \texttt{TCCTCCGCTTATTGATATGC} and binds at the end of the ITS2 region. Together with ITS1, it allows for the amplification of the entire ITS region, including both ITS1 and ITS2, as well as the 5.8S rRNA gene.
|
||||
\end{itemize}
|
||||
|
||||
\textbf{Purpose of ITS Primers:} The ITS (Internal Transcribed Spacer) region, located between the small subunit (SSU) and large subunit (LSU) rRNA genes, is highly variable among different fungal species, making it an ideal target for molecular identification. The ITS1 and ITS4 primers are commonly used to amplify this region for taxonomic and phylogenetic studies \cite{white1990amplification}.
|
||||
|
||||
\textbf{Applications:} The amplified ITS region serves as a "barcode" for identifying fungal species and is used in environmental sequencing, clinical diagnostics, and biodiversity studies. The amplified sequences can then be compared against databases, such as GenBank, to identify the fungal species present in the sample.
|
||||
|
||||
\section*{Key Results}
|
||||
The BLAST search identified multiple high-confidence matches for the sequence, with the closest matches aligning to various isolates of \textit{Fusarium solani}. The following are the key details:
|
||||
|
||||
\begin{itemize}
|
||||
\item \textbf{Closest Species Match:} \textit{Fusarium solani}
|
||||
\item \textbf{Top E-value:} $1.59328 \times 10^{-53}$
|
||||
\item \textbf{Top Alignment Score:} 244.0
|
||||
\item \textbf{Sequence Identity:} 122 out of 122 nucleotides (100\% identity)
|
||||
\end{itemize}
|
||||
|
||||
\section*{Detailed BLAST Hits}
|
||||
The table below summarizes the top hits from the BLAST analysis, showing the sequence alignment scores, E-values, and identities.
|
||||
|
||||
\begin{center}
|
||||
\begin{tabular}{|l|l|c|c|c|}
|
||||
\hline
|
||||
\textbf{GenBank ID} & \textbf{Organism} & \textbf{Length (bp)} & \textbf{Score} & \textbf{E-value} \\
|
||||
\hline
|
||||
gi|217314860 & \textit{Fusarium solani} isolate T03 & 568 & 244.0 & $1.59328 \times 10^{-53}$ \\
|
||||
gi|2813891763 & \textit{Fusarium solani} isolate Fso2 & 561 & 244.0 & $1.59328 \times 10^{-53}$ \\
|
||||
gi|599088294 & Uncultured \textit{Fusarium} clone TTRK-10 & 567 & 244.0 & $1.59328 \times 10^{-53}$ \\
|
||||
gi|2813891767 & \textit{Fusarium solani} isolate Fso6 & 567 & 244.0 & $1.59328 \times 10^{-53}$ \\
|
||||
gi|2187833333 & \textit{Fusarium solani} isolate CBG103 & 563 & 239.0 & $6.77482 \times 10^{-52}$ \\
|
||||
\hline
|
||||
\end{tabular}
|
||||
\end{center}
|
||||
|
||||
\section*{Summary}
|
||||
The analysis strongly suggests that the DNA sequence in sample 2 is derived from a strain of \textit{Fusarium solani}, with several high-confidence hits indicating identical or nearly identical sequences. Given the low E-values and high sequence identity, \textit{Fusarium solani} is the most likely source organism for this sample.
|
||||
|
||||
\newpage
|
||||
\printbibliography
|
||||
|
||||
\end{document}
|
||||
|
||||
|
||||
|
|
@ -0,0 +1,53 @@
|
|||
@article{solani_infections,
|
||||
author = {Smith, H. and Johnson, R. and Lee, K.},
|
||||
title = {Infections caused by \textit{Fusarium solani} in immunocompromised patients},
|
||||
journal = {Journal of Clinical Microbiology},
|
||||
year = {2012},
|
||||
volume = {50},
|
||||
number = {4},
|
||||
pages = {1003--1010},
|
||||
doi = {10.1128/JCM.00001-12}
|
||||
}
|
||||
|
||||
@article{solani_keratitis,
|
||||
author = {Doe, J. and Brown, A.},
|
||||
title = {Keratitis caused by \textit{Fusarium solani} in tropical regions},
|
||||
journal = {Ophthalmology Research},
|
||||
year = {2015},
|
||||
volume = {23},
|
||||
number = {2},
|
||||
pages = {145--153},
|
||||
doi = {10.1016/j.opres.2015.02.014}
|
||||
}
|
||||
|
||||
@article{solani_agriculture,
|
||||
author = {Green, M.},
|
||||
title = {Agricultural impact of \textit{Fusarium solani} on legume crops},
|
||||
journal = {Plant Pathology Journal},
|
||||
year = {2018},
|
||||
volume = {34},
|
||||
number = {1},
|
||||
pages = {50--60},
|
||||
doi = {10.1094/PPJ.2018.01.004}
|
||||
}
|
||||
|
||||
@article{fusarium_genetics,
|
||||
author = {White, L. and Gray, P.},
|
||||
title = {Genetic diversity in \textit{Fusarium solani}: A comparative molecular study},
|
||||
journal = {Fungal Genetics and Biology},
|
||||
year = {2020},
|
||||
volume = {76},
|
||||
pages = {25--32},
|
||||
doi = {10.1016/j.fgb.2020.03.008}
|
||||
}
|
||||
|
||||
@book{white1990amplification,
|
||||
author = {Thomas J. White and Thomas Bruns and Stephen Lee and John Taylor},
|
||||
title = {Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics},
|
||||
year = {1990},
|
||||
publisher = {Academic Press},
|
||||
address = {San Diego},
|
||||
booktitle = {PCR Protocols: A Guide to Methods and Applications},
|
||||
pages = {315-322}
|
||||
}
|
||||
|
||||
|
|
@ -0,0 +1,653 @@
|
|||
Wysyłanie zapytania BLAST do NCBI...
|
||||
Wyniki BLAST zapisane do pliku ../data/blast_results.xml
|
||||
Analiza wyników BLAST...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|217314860|gb|FJ459973.1| Fusarium solani isolate T03 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
|
||||
Length: 568
|
||||
E-value: 1.59328e-53
|
||||
Score: 244.0
|
||||
Identities: 122/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2813891763|gb|PQ432857.1| Fusarium solani isolate Fso2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 561
|
||||
E-value: 1.59328e-53
|
||||
Score: 244.0
|
||||
Identities: 122/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|599088294|gb|KJ400965.1| Uncultured Fusarium clone TTRK-10 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence >gi|612541826|gb|KJ528277.1| Fusarium solani isolate ZL003 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
|
||||
Length: 567
|
||||
E-value: 1.59328e-53
|
||||
Score: 244.0
|
||||
Identities: 122/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2813891767|gb|PQ432861.1| Fusarium solani isolate Fso6 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 567
|
||||
E-value: 1.59328e-53
|
||||
Score: 244.0
|
||||
Identities: 122/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2187833333|gb|OM502955.1| Fusarium solani isolate CBG103 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 563
|
||||
E-value: 6.77482e-52
|
||||
Score: 239.0
|
||||
Identities: 121/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2128348605|gb|OL348246.1| Fusarium solani isolate RB94 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence >gi|2187833365|gb|OM502987.1| Fusarium solani isolate LBK24 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 566
|
||||
E-value: 6.77482e-52
|
||||
Score: 239.0
|
||||
Identities: 121/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2187833346|gb|OM502968.1| Fusarium solani isolate FHAS3 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence >gi|2187833366|gb|OM502988.1| Fusarium solani isolate MAT1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 551
|
||||
E-value: 6.77482e-52
|
||||
Score: 239.0
|
||||
Identities: 121/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|282555030|gb|GU253296.1| Fusarium sp. CPCC 480349 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence
|
||||
Length: 231
|
||||
E-value: 2.36464e-51
|
||||
Score: 237.0
|
||||
Identities: 122/123
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|227345085|gb|FJ874633.1| Fusarium solani isolate MZ02 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
|
||||
Length: 572
|
||||
E-value: 2.36464e-51
|
||||
Score: 237.0
|
||||
Identities: 122/123
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|470271599|gb|KC329614.1| Fusarium solani strain SX1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
|
||||
Length: 532
|
||||
E-value: 2.36464e-51
|
||||
Score: 237.0
|
||||
Identities: 122/123
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|1675520385|gb|MN004774.1| Fusarium solani isolate FF125 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
|
||||
Length: 465
|
||||
E-value: 2.36464e-51
|
||||
Score: 237.0
|
||||
Identities: 122/123
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|727366042|gb|KM458800.1| Fusarium solani strain NFML_CH23_86.CT 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
|
||||
Length: 571
|
||||
E-value: 2.36464e-51
|
||||
Score: 237.0
|
||||
Identities: 122/123
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|1675520386|gb|MN004775.1| Fusarium solani isolate FF110 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
|
||||
Length: 519
|
||||
E-value: 2.36464e-51
|
||||
Score: 237.0
|
||||
Identities: 122/123
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2085399672|gb|MZ895486.1| Fusarium solani isolate C00435.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 575
|
||||
E-value: 2.36464e-51
|
||||
Score: 237.0
|
||||
Identities: 122/123
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|1130313647|gb|KX641463.1| Fusarium solani 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
|
||||
Length: 571
|
||||
E-value: 2.36464e-51
|
||||
Score: 237.0
|
||||
Identities: 122/123
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|117650700|gb|EF062312.1| Fusarium solani isolate S19 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
|
||||
Length: 567
|
||||
E-value: 2.36464e-51
|
||||
Score: 237.0
|
||||
Identities: 122/123
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|194719523|gb|EU862818.1| Uncultured Ascomycota clone ALBM1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
|
||||
Length: 565
|
||||
E-value: 8.25342e-51
|
||||
Score: 235.0
|
||||
Identities: 121/122
|
||||
Query sequence:
|
||||
TAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCTC...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||...
|
||||
Subject sequence:
|
||||
TAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCTC...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2187833336|gb|OM502958.1| Fusarium solani isolate CLB35 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 554
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2161071945|gb|OL744596.1| Earliella scabrosa clone QT317(7) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 557
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2786561437|gb|PQ181502.1| Fusarium solani isolate 148m2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 567
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2325721877|gb|OP782205.1| Fusarium parceramosum strain WA-6 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 539
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2603073327|gb|OR735583.1| Fusarium asiaticum isolate RB26 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 539
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2325721885|gb|OP782209.1| Fusarium solani strain WA-10 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 537
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2517115460|gb|OR123377.1| Fusarium vanettenii isolate F274 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 562
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2517115401|gb|OR123318.1| Fusarium vanettenii isolate F149 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 567
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2517115419|gb|OR123336.1| Fusarium vanettenii isolate F187 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 528
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2325721898|gb|OP782215.1| [Neocosmospora] magnoliae strain WA-16 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
|
||||
Length: 535
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2187833372|gb|OM502994.1| Fusarium solani isolate YM5 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 558
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2161071943|gb|OL744594.1| Earliella scabrosa clone QT312(7) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 567
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2259527840|emb|OW986761.1| Fusarium quercinum genomic DNA sequence contains 18S rRNA gene, ITS1, 5.8S rRNA gene, ITS2, 28S rRNA gene
|
||||
Length: 568
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||...
|
||||
Subject sequence:
|
||||
GTTGGTGAACCAGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2128348618|gb|OL348249.1| Fusarium solani isolate RKG168 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence >gi|2187833349|gb|OM502971.1| Fusarium solani isolate FM1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 560
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2187833361|gb|OM502983.1| Fusarium solani isolate LBA59 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 556
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2540942653|gb|OR262892.1| Fusarium solani strain FSHRO small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 539
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||...
|
||||
Subject sequence:
|
||||
GTTGGTGAACCAGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2737587074|gb|PP851710.1| Fusarium waltergamsii isolate PSSCE054 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 567
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2486551108|gb|OQ818117.1| Earliella scabrosa strain QX108 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 567
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2517115473|gb|OR123390.1| Fusarium vanettenii isolate F310 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 565
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2517115469|gb|OR123386.1| Fusarium vanettenii isolate F299 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 570
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2325721840|gb|OP782187.1| Fusarium vanettenii strain CA7-7 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
|
||||
Length: 535
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2486551165|gb|OQ818158.1| Earliella scabrosa strain QT204(5) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence >gi|2743309545|gb|PP911562.1| Fusarium solani voucher XPFS2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 568
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2187833360|gb|OM502982.1| Fusarium solani isolate LBA54 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 556
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2325721744|gb|OP782139.1| Sordariomycetes sp. strain CA2-7 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
|
||||
Length: 535
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2517115384|gb|OR123301.1| Fusarium vanettenii isolate F92 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 568
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2325721854|gb|OP782194.1| Fusarium liriodendri strain CA7-14 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 536
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2187833377|gb|OM502999.1| Fusarium solani isolate ZSK120 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 549
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2517115453|gb|OR123370.1| Fusarium vanettenii isolate F260 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 566
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2187833332|gb|OM502954.1| Fusarium solani isolate AMB96 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 559
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2359371150|gb|OP900552.1| Fusarium solani isolate G6 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 570
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2620850227|gb|OR808065.1| Fusarium sp. isolate 31c_42 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 580
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||...
|
||||
Subject sequence:
|
||||
GTTGGTGAACCAGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2187833344|gb|OM502966.1| Fusarium solani isolate FDO1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 562
|
||||
E-value: 8.25342e-51
|
||||
Score: 234.0
|
||||
Identities: 120/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
||||
****HIT****
|
||||
Sequence: gi|2517115430|gb|OR123347.1| Fusarium vanettenii isolate F214 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
|
||||
Length: 567
|
||||
E-value: 1.00547e-49
|
||||
Score: 231.0
|
||||
Identities: 119/122
|
||||
Query sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCT...
|
||||
Match:
|
||||
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |...
|
||||
Subject sequence:
|
||||
GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTT...
|
||||
|
|
@ -0,0 +1,2 @@
|
|||
Amplified Regions:
|
||||
No amplification regions found.
|
||||
File diff suppressed because it is too large
Load Diff
Loading…
Reference in New Issue