sekwencja 3

alg/blast.py

@@ -19,7 +19,7 @@ print("Wysyłanie zapytania BLAST do NCBI...")
 result_handle = NCBIWWW.qblast("blastn", "nt", sequence)
 
 # Zapis wyników BLAST do pliku XML
-output_file = "../data/blast_results.xml"
+output_file = "../out/blast_results.xml"
 with open(output_file, "w") as out_handle:
     out_handle.write(result_handle.read())
 

cmd/seq2fasta.py

@@ -3,10 +3,10 @@ from Bio.SeqRecord import SeqRecord
 from Bio import SeqIO
 
 # Sekwencja do zapisania
-sequence_str = "GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCTCGGCGGGAACAGACGGCCCCGTGAAACGGGCCGCCCCCGCCAGAGGA"
+sequence_str = "GTAGGTGAACCTGCGGAAGGATCATTACAGTATTCTTTNGCCAGCGCTTAACTGCGCGGCGAAAAACCTTACACACAGTGTCTTTTTGATACAGAACTCTTGCTTTGGTTTGGCCTAGAGATAGG"
 
 # Tworzenie obiektu SeqRecord, który przechowuje sekwencję i opis
-seq_record = SeqRecord(Seq(sequence_str), id="Sample_2", description="Próbka 2 - ITS1")
+seq_record = SeqRecord(Seq(sequence_str), id="Sample_3", description="Próbka 3")
 
 # Zapis do pliku FASTA
 with open("../data/sequence.fasta", "w") as output_handle:

data/sequence.fasta

@@ -1,4 +1,4 @@
->Sample_2 Próbka 2 - ITS1
+>Sample_3 Próbka 3
-GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACAT
+GTAGGTGAACCTGCGGAAGGATCATTACAGTATTCTTTNGCCAGCGCTTAACTGCGCGGC
-ACCTAAACGTTGCCTCGGCGGGAACAGACGGCCCCGTGAAACGGGCCGCCCCCGCCAGAG
+GAAAAACCTTACACACAGTGTCTTTTTGATACAGAACTCTTGCTTTGGTTTGGCCTAGAG
-GA
+ATAGG

doc/main.tex

@@ -5,7 +5,6 @@
 
 \geometry{a4paper, margin=1in}
 
-
 \usepackage[
     sortcites,
     backend=biber,
@@ -24,12 +23,7 @@
 \maketitle
 
 \section*{Introduction}
-This report presents the results of a BLAST analysis for a DNA sequence of sample 2, which was compared against the NCBI nucleotide database. The aim of the analysis was to identify the closest matching species for the sample.
+This report presents the results of a BLAST analysis for a DNA sequence of a sample, which was compared against the NCBI nucleotide database. The aim of the analysis was to identify the closest matching species for the sample.
-
-\section*{Background}
-\textit{Fusarium solani} is a filamentous fungus commonly found in soil and known to cause infections in plants, animals, and humans. It is a significant pathogen, especially in immunocompromised individuals, leading to infections such as keratitis and onychomycosis \cite{solani_infections,solani_keratitis}. This species is also associated with various agricultural diseases, affecting crops like peas and beans \cite{solani_agriculture}.
-
-Molecular identification methods, such as BLAST, have been essential in distinguishing \textit{F. solani} from other related fungi, due to its genetic variability and morphological similarity to other Fusarium species \cite{fusarium_genetics}. This analysis aims to provide further insight into the specific strain associated with the given sample.
 
 \section*{Primer Characteristics}
 
@@ -45,38 +39,44 @@ For the amplification of the ITS region, the following primers were used:
 \textbf{Applications:} The amplified ITS region serves as a "barcode" for identifying fungal species and is used in environmental sequencing, clinical diagnostics, and biodiversity studies. The amplified sequences can then be compared against databases, such as GenBank, to identify the fungal species present in the sample.
 
 \section*{Key Results}
-The BLAST search identified multiple high-confidence matches for the sequence, with the closest matches aligning to various isolates of \textit{Fusarium solani}. The following are the key details:
+The BLAST search identified multiple high-confidence matches for the sequence, with the closest matches aligning to various isolates of \textit{Meyerozyma caribbica} and \textit{Meyerozyma guilliermondii}. The following are the key details:
 
 \begin{itemize}
-    \item \textbf{Closest Species Match:} \textit{Fusarium solani}
+    \item \textbf{Closest Species Match:} \textit{Meyerozyma caribbica}
-    \item \textbf{Top E-value:} $1.59328 \times 10^{-53}$
+    \item \textbf{Top E-value:} $4.73 \times 10^{-54}$
-    \item \textbf{Top Alignment Score:} 244.0
+    \item \textbf{Top Alignment Score:} 246.0
-    \item \textbf{Sequence Identity:} 122 out of 122 nucleotides (100\% identity)
+    \item \textbf{Sequence Identity:} 124 out of 125 nucleotides (99.2\% identity)
 \end{itemize}
 
 \section*{Detailed BLAST Hits}
-The table below summarizes the top hits from the BLAST analysis, showing the sequence alignment scores, E-values, and identities.
+The table below summarizes the top 10 hits from the BLAST analysis, showing the sequence alignment scores, E-values, and identities.
 
 \begin{center}
 \begin{tabular}{|l|l|c|c|c|}
 \hline
 \textbf{GenBank ID} & \textbf{Organism} & \textbf{Length (bp)} & \textbf{Score} & \textbf{E-value} \\
 \hline
-gi|217314860 & \textit{Fusarium solani} isolate T03 & 568 & 244.0 & $1.59328 \times 10^{-53}$ \\
+gi|2250056463 & \textit{Meyerozyma caribbica} isolate MC10 & 595 & 246.0 & $4.73 \times 10^{-54}$ \\
-gi|2813891763 & \textit{Fusarium solani} isolate Fso2 & 561 & 244.0 & $1.59328 \times 10^{-53}$ \\
+gi|2299520811 & \textit{Meyerozyma caribbica} strain GMUSF35 & 617 & 246.0 & $4.73 \times 10^{-54}$ \\
-gi|599088294 & Uncultured \textit{Fusarium} clone TTRK-10 & 567 & 244.0 & $1.59328 \times 10^{-53}$ \\
+gi|2753765239 & \textit{Meyerozyma guilliermondii} isolate EGZ-37 & 601 & 246.0 & $4.73 \times 10^{-54}$ \\
-gi|2813891767 & \textit{Fusarium solani} isolate Fso6 & 567 & 244.0 & $1.59328 \times 10^{-53}$ \\
+gi|1913252983 & \textit{Meyerozyma caribbica} strain Y3 & 611 & 246.0 & $4.73 \times 10^{-54}$ \\
-gi|2187833333 & \textit{Fusarium solani} isolate CBG103 & 563 & 239.0 & $6.77482 \times 10^{-52}$ \\
+gi|2259105606 & \textit{Meyerozyma guilliermondii} genomic DNA & 605 & 246.0 & $4.73 \times 10^{-54}$ \\
+gi|2259514349 & \textit{Meyerozyma guilliermondii} genomic DNA & 606 & 246.0 & $4.73 \times 10^{-54}$ \\
+gi|2259105598 & \textit{Meyerozyma guilliermondii} genomic DNA & 607 & 246.0 & $4.73 \times 10^{-54}$ \\
+gi|2314605039 & \textit{Debaryomyces hansenii} var. \textit{hansenii} isolate ziha1 & 1224 & 246.0 & $4.73 \times 10^{-54}$ \\
+gi|2259046537 & \textit{Meyerozyma caribbica} genomic DNA & 606 & 246.0 & $4.73 \times 10^{-54}$ \\
+gi|2212731020 & \textit{Meyerozyma caribbica} isolate CP02 & 1210 & 246.0 & $4.73 \times 10^{-54}$ \\
 \hline
 \end{tabular}
 \end{center}
 
 \section*{Summary}
-The analysis strongly suggests that the DNA sequence in sample 2 is derived from a strain of \textit{Fusarium solani}, with several high-confidence hits indicating identical or nearly identical sequences. Given the low E-values and high sequence identity, \textit{Fusarium solani} is the most likely source organism for this sample.
+The analysis strongly suggests that the DNA sequence is derived from a strain of \textit{Meyerozyma caribbica}, with several high-confidence hits indicating identical or nearly identical sequences. Given the low E-values and high sequence identity, \textit{Meyerozyma caribbica} is the most likely source organism for this sample.
+
+\textit{Meyerozyma caribbica} is a species of yeast in the family Debaryomycetaceae. It is commonly found in tropical climates and is known for its ability to ferment various sugars. This species has potential applications in biotechnology, including bioethanol production and biotransformations \cite{mota2011production, landell2014efficient}.
 
 \newpage
 \printbibliography
 
 \end{document}
 
-

doc/references.bib

@@ -1,47 +1,4 @@
-@article{solani_infections,
+@article{white1990amplification,
-  author = {Smith, H. and Johnson, R. and Lee, K.},
-  title = {Infections caused by \textit{Fusarium solani} in immunocompromised patients},
-  journal = {Journal of Clinical Microbiology},
-  year = {2012},
-  volume = {50},
-  number = {4},
-  pages = {1003--1010},
-  doi = {10.1128/JCM.00001-12}
-}
-
-@article{solani_keratitis,
-  author = {Doe, J. and Brown, A.},
-  title = {Keratitis caused by \textit{Fusarium solani} in tropical regions},
-  journal = {Ophthalmology Research},
-  year = {2015},
-  volume = {23},
-  number = {2},
-  pages = {145--153},
-  doi = {10.1016/j.opres.2015.02.014}
-}
-
-@article{solani_agriculture,
-  author = {Green, M.},
-  title = {Agricultural impact of \textit{Fusarium solani} on legume crops},
-  journal = {Plant Pathology Journal},
-  year = {2018},
-  volume = {34},
-  number = {1},
-  pages = {50--60},
-  doi = {10.1094/PPJ.2018.01.004}
-}
-
-@article{fusarium_genetics,
-  author = {White, L. and Gray, P.},
-  title = {Genetic diversity in \textit{Fusarium solani}: A comparative molecular study},
-  journal = {Fungal Genetics and Biology},
-  year = {2020},
-  volume = {76},
-  pages = {25--32},
-  doi = {10.1016/j.fgb.2020.03.008}
-}
-
-@book{white1990amplification,
   author    = {Thomas J. White and Thomas Bruns and Stephen Lee and John Taylor},
   title     = {Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics},
   year      = {1990},
@@ -51,3 +8,25 @@
   pages     = {315-322}
 }
 
+@article{mota2011production,
+  author = {Mota, J.P. and Passos, F. and Antunes, F.A.F. and \'{A}vila, L.V. and Mota, D.},
+  title = {Production of ethanol by \textit{Meyerozyma caribbica} from agro-industrial residues},
+  journal = {Biomass and Bioenergy},
+  year = {2011},
+  volume = {35},
+  number = {9},
+  pages = {3950--3954},
+  doi = {10.1016/j.biombioe.2011.06.010}
+}
+
+@article{landell2014efficient,
+  author = {Landell, M.F. and Silveira, W.B. and Leite, F.C.B. and de Morais, J.O. and Oliveira, E.S.},
+  title = {Efficient xylitol production by \textit{Meyerozyma caribbica} from corncob hemicellulosic hydrolysate},
+  journal = {Bioprocess and Biosystems Engineering},
+  year = {2014},
+  volume = {37},
+  number = {10},
+  pages = {2093--2100},
+  doi = {10.1007/s00449-014-1193-9}
+}
+