This commit is contained in:
baiobelfer 2024-10-23 18:30:31 +02:00
commit a933aa76f2
18 changed files with 6508 additions and 0 deletions

0
README Normal file
View File

23
doc/__commit Normal file
View File

@ -0,0 +1,23 @@
# Pobranie pełnego UUID commita
full_uuid=`git log -1 --format="%H"`
# Pobranie daty commita
commit_date=`git log -1 --format="%cd" --date=iso`
# Pobranie komentarza z commita
commit_message=`git log -1 --format="%s"`
# Pobranie tagu z commita, jeśli istnieje
commit_tag=`git describe --tags --exact-match 2>/dev/null`
# Generowanie pliku commit.tex z UUID, datą, komentarzem i tagiem (jeśli istnieje)
echo "\\newcommand{\\commitUUID}{${full_uuid}}" > commit.tex
echo "\\newcommand{\\commitDate}{${commit_date}}" >> commit.tex
echo "\\newcommand{\\commitComment}{${commit_message}}" >> commit.tex
# Sprawdzenie, czy istnieje tag
if [ -n "$commit_tag" ]; then
echo "\\newcommand{\\commitTag}{${commit_tag}}" >> commit.tex
else
echo "\\newcommand{\\commitTag}{}" >> commit.tex
fi

4
doc/commit.tex Normal file
View File

@ -0,0 +1,4 @@
\newcommand{\commitUUID}{98463cfa7bc8b50867b6481bc63a28b9eb0d4478}
\newcommand{\commitDate}{2024-10-22 10:31:59 +0200}
\newcommand{\commitComment}{start}
\newcommand{\commitTag}{}

22
doc/main.aux Normal file
View File

@ -0,0 +1,22 @@
\relax
\providecommand{\transparent@use}[1]{}
\abx@aux@refcontext{nty/global//global/global}
\providecommand\babel@aux[2]{}
\@nameuse{bbl@beforestart}
\catcode `"\active
\abx@aux@cite{0}{doudnaNewFrontierGenome2014}
\abx@aux@segm{0}{0}{doudnaNewFrontierGenome2014}
\abx@aux@cite{0}{jinekProgrammableDualRNAGuidedDNA2012}
\abx@aux@segm{0}{0}{jinekProgrammableDualRNAGuidedDNA2012}
\abx@aux@cite{0}{jinekProgrammableDualRNAGuidedDNA2012}
\abx@aux@segm{0}{0}{jinekProgrammableDualRNAGuidedDNA2012}
\abx@aux@cite{0}{montecilloCRISPRCas9SystemPlant2020}
\abx@aux@segm{0}{0}{montecilloCRISPRCas9SystemPlant2020}
\abx@aux@cite{0}{doudnaNewFrontierGenome2014}
\abx@aux@segm{0}{0}{doudnaNewFrontierGenome2014}
\babel@aux{polish}{}
\newlabel{sec:crispr}{{}{1}}
\newlabel{sec:bio}{{}{3}}
\abx@aux@read@bbl@mdfivesum{nobblfile}
\abx@aux@read@bblrerun
\gdef \@abspage@last{3}

2397
doc/main.bcf Normal file

File diff suppressed because it is too large Load Diff

776
doc/main.log Normal file
View File

@ -0,0 +1,776 @@
This is pdfTeX, Version 3.141592653-2.6-1.40.24 (TeX Live 2022/Debian) (preloaded format=pdflatex 2024.9.20) 23 OCT 2024 18:30
entering extended mode
restricted \write18 enabled.
%&-line parsing enabled.
**main
(./main.tex
LaTeX2e <2022-11-01> patch level 1
L3 programming layer <2023-01-16>
(/usr/share/texlive/texmf-dist/tex/latex/base/report.cls
Document Class: report 2022/07/02 v1.4n Standard LaTeX document class
(/usr/share/texlive/texmf-dist/tex/latex/base/size10.clo
File: size10.clo 2022/07/02 v1.4n Standard LaTeX file (size option)
)
\c@part=\count185
\c@chapter=\count186
\c@section=\count187
\c@subsection=\count188
\c@subsubsection=\count189
\c@paragraph=\count190
\c@subparagraph=\count191
\c@figure=\count192
\c@table=\count193
\abovecaptionskip=\skip48
\belowcaptionskip=\skip49
\bibindent=\dimen140
)
(/usr/share/texlive/texmf-dist/tex/latex/geometry/geometry.sty
Package: geometry 2020/01/02 v5.9 Page Geometry
(/usr/share/texlive/texmf-dist/tex/latex/graphics/keyval.sty
Package: keyval 2022/05/29 v1.15 key=value parser (DPC)
\KV@toks@=\toks16
)
(/usr/share/texlive/texmf-dist/tex/generic/iftex/ifvtex.sty
Package: ifvtex 2019/10/25 v1.7 ifvtex legacy package. Use iftex instead.
(/usr/share/texlive/texmf-dist/tex/generic/iftex/iftex.sty
Package: iftex 2022/02/03 v1.0f TeX engine tests
))
\Gm@cnth=\count194
\Gm@cntv=\count195
\c@Gm@tempcnt=\count196
\Gm@bindingoffset=\dimen141
\Gm@wd@mp=\dimen142
\Gm@odd@mp=\dimen143
\Gm@even@mp=\dimen144
\Gm@layoutwidth=\dimen145
\Gm@layoutheight=\dimen146
\Gm@layouthoffset=\dimen147
\Gm@layoutvoffset=\dimen148
\Gm@dimlist=\toks17
)
(/usr/share/texlive/texmf-dist/tex/latex/biblatex/biblatex.sty
Package: biblatex 2022/07/12 v3.18b programmable bibliographies (PK/MW)
(/usr/share/texlive/texmf-dist/tex/generic/pdftexcmds/pdftexcmds.sty
Package: pdftexcmds 2020-06-27 v0.33 Utility functions of pdfTeX for LuaTeX (HO
)
(/usr/share/texlive/texmf-dist/tex/generic/infwarerr/infwarerr.sty
Package: infwarerr 2019/12/03 v1.5 Providing info/warning/error messages (HO)
)
(/usr/share/texlive/texmf-dist/tex/generic/ltxcmds/ltxcmds.sty
Package: ltxcmds 2020-05-10 v1.25 LaTeX kernel commands for general use (HO)
)
Package pdftexcmds Info: \pdf@primitive is available.
Package pdftexcmds Info: \pdf@ifprimitive is available.
Package pdftexcmds Info: \pdfdraftmode found.
)
(/usr/share/texlive/texmf-dist/tex/latex/etoolbox/etoolbox.sty
Package: etoolbox 2020/10/05 v2.5k e-TeX tools for LaTeX (JAW)
\etb@tempcnta=\count197
)
(/usr/share/texlive/texmf-dist/tex/latex/kvoptions/kvoptions.sty
Package: kvoptions 2022-06-15 v3.15 Key value format for package options (HO)
(/usr/share/texlive/texmf-dist/tex/latex/kvsetkeys/kvsetkeys.sty
Package: kvsetkeys 2022-10-05 v1.19 Key value parser (HO)
))
(/usr/share/texlive/texmf-dist/tex/latex/logreq/logreq.sty
Package: logreq 2010/08/04 v1.0 xml request logger
\lrq@indent=\count198
(/usr/share/texlive/texmf-dist/tex/latex/logreq/logreq.def
File: logreq.def 2010/08/04 v1.0 logreq spec v1.0
))
(/usr/share/texlive/texmf-dist/tex/latex/base/ifthen.sty
Package: ifthen 2022/04/13 v1.1d Standard LaTeX ifthen package (DPC)
)
(/usr/share/texlive/texmf-dist/tex/latex/url/url.sty
\Urlmuskip=\muskip16
Package: url 2013/09/16 ver 3.4 Verb mode for urls, etc.
)
\c@tabx@nest=\count199
\c@listtotal=\count266
\c@listcount=\count267
\c@liststart=\count268
\c@liststop=\count269
\c@citecount=\count270
\c@citetotal=\count271
\c@multicitecount=\count272
\c@multicitetotal=\count273
\c@instcount=\count274
\c@maxnames=\count275
\c@minnames=\count276
\c@maxitems=\count277
\c@minitems=\count278
\c@citecounter=\count279
\c@maxcitecounter=\count280
\c@savedcitecounter=\count281
\c@uniquelist=\count282
\c@uniquename=\count283
\c@refsection=\count284
\c@refsegment=\count285
\c@maxextratitle=\count286
\c@maxextratitleyear=\count287
\c@maxextraname=\count288
\c@maxextradate=\count289
\c@maxextraalpha=\count290
\c@abbrvpenalty=\count291
\c@highnamepenalty=\count292
\c@lownamepenalty=\count293
\c@maxparens=\count294
\c@parenlevel=\count295
\blx@tempcnta=\count296
\blx@tempcntb=\count297
\blx@tempcntc=\count298
\c@blx@maxsection=\count299
\blx@maxsegment@0=\count300
\blx@notetype=\count301
\blx@parenlevel@text=\count302
\blx@parenlevel@foot=\count303
\blx@sectionciteorder@0=\count304
\blx@sectionciteorderinternal@0=\count305
\blx@entrysetcounter=\count306
\blx@biblioinstance=\count307
\labelnumberwidth=\skip50
\labelalphawidth=\skip51
\biblabelsep=\skip52
\bibitemsep=\skip53
\bibnamesep=\skip54
\bibinitsep=\skip55
\bibparsep=\skip56
\bibhang=\skip57
\blx@bcfin=\read2
\blx@bcfout=\write3
\blx@langwohyphens=\language87
\c@mincomprange=\count308
\c@maxcomprange=\count309
\c@mincompwidth=\count310
Package biblatex Info: Trying to load biblatex default data model...
Package biblatex Info: ... file 'blx-dm.def' found.
(/usr/share/texlive/texmf-dist/tex/latex/biblatex/blx-dm.def
File: blx-dm.def 2022/07/12 v3.18b biblatex localization (PK/MW)
)
Package biblatex Info: Trying to load biblatex custom data model...
Package biblatex Info: ... file 'biblatex-dm.cfg' not found.
\c@afterword=\count311
\c@savedafterword=\count312
\c@annotator=\count313
\c@savedannotator=\count314
\c@author=\count315
\c@savedauthor=\count316
\c@bookauthor=\count317
\c@savedbookauthor=\count318
\c@commentator=\count319
\c@savedcommentator=\count320
\c@editor=\count321
\c@savededitor=\count322
\c@editora=\count323
\c@savededitora=\count324
\c@editorb=\count325
\c@savededitorb=\count326
\c@editorc=\count327
\c@savededitorc=\count328
\c@foreword=\count329
\c@savedforeword=\count330
\c@holder=\count331
\c@savedholder=\count332
\c@introduction=\count333
\c@savedintroduction=\count334
\c@namea=\count335
\c@savednamea=\count336
\c@nameb=\count337
\c@savednameb=\count338
\c@namec=\count339
\c@savednamec=\count340
\c@translator=\count341
\c@savedtranslator=\count342
\c@shortauthor=\count343
\c@savedshortauthor=\count344
\c@shorteditor=\count345
\c@savedshorteditor=\count346
\c@labelname=\count347
\c@savedlabelname=\count348
\c@institution=\count349
\c@savedinstitution=\count350
\c@lista=\count351
\c@savedlista=\count352
\c@listb=\count353
\c@savedlistb=\count354
\c@listc=\count355
\c@savedlistc=\count356
\c@listd=\count357
\c@savedlistd=\count358
\c@liste=\count359
\c@savedliste=\count360
\c@listf=\count361
\c@savedlistf=\count362
\c@location=\count363
\c@savedlocation=\count364
\c@organization=\count365
\c@savedorganization=\count366
\c@origlocation=\count367
\c@savedoriglocation=\count368
\c@origpublisher=\count369
\c@savedorigpublisher=\count370
\c@publisher=\count371
\c@savedpublisher=\count372
\c@language=\count373
\c@savedlanguage=\count374
\c@origlanguage=\count375
\c@savedoriglanguage=\count376
\c@pageref=\count377
\c@savedpageref=\count378
\shorthandwidth=\skip58
\shortjournalwidth=\skip59
\shortserieswidth=\skip60
\shorttitlewidth=\skip61
\shortauthorwidth=\skip62
\shorteditorwidth=\skip63
\locallabelnumberwidth=\skip64
\locallabelalphawidth=\skip65
\localshorthandwidth=\skip66
\localshortjournalwidth=\skip67
\localshortserieswidth=\skip68
\localshorttitlewidth=\skip69
\localshortauthorwidth=\skip70
\localshorteditorwidth=\skip71
Package biblatex Info: Trying to load compatibility code...
Package biblatex Info: ... file 'blx-compat.def' found.
(/usr/share/texlive/texmf-dist/tex/latex/biblatex/blx-compat.def
File: blx-compat.def 2022/07/12 v3.18b biblatex compatibility (PK/MW)
)
Package biblatex Info: Trying to load generic definitions...
Package biblatex Info: ... file 'biblatex.def' found.
(/usr/share/texlive/texmf-dist/tex/latex/biblatex/biblatex.def
File: biblatex.def 2022/07/12 v3.18b biblatex compatibility (PK/MW)
\c@textcitecount=\count379
\c@textcitetotal=\count380
\c@textcitemaxnames=\count381
\c@biburlbigbreakpenalty=\count382
\c@biburlbreakpenalty=\count383
\c@biburlnumpenalty=\count384
\c@biburlucpenalty=\count385
\c@biburllcpenalty=\count386
\biburlbigskip=\muskip17
\biburlnumskip=\muskip18
\biburlucskip=\muskip19
\biburllcskip=\muskip20
\c@smartand=\count387
)
Package biblatex Info: Trying to load bibliography style 'numeric'...
Package biblatex Info: ... file 'numeric.bbx' found.
(/usr/share/texlive/texmf-dist/tex/latex/biblatex/bbx/numeric.bbx
File: numeric.bbx 2022/07/12 v3.18b biblatex bibliography style (PK/MW)
Package biblatex Info: Trying to load bibliography style 'standard'...
Package biblatex Info: ... file 'standard.bbx' found.
(/usr/share/texlive/texmf-dist/tex/latex/biblatex/bbx/standard.bbx
File: standard.bbx 2022/07/12 v3.18b biblatex bibliography style (PK/MW)
\c@bbx:relatedcount=\count388
\c@bbx:relatedtotal=\count389
))
Package biblatex Info: Trying to load citation style 'numeric'...
Package biblatex Info: ... file 'numeric.cbx' found.
(/usr/share/texlive/texmf-dist/tex/latex/biblatex/cbx/numeric.cbx
File: numeric.cbx 2022/07/12 v3.18b biblatex citation style (PK/MW)
Package biblatex Info: Redefining '\cite'.
Package biblatex Info: Redefining '\parencite'.
Package biblatex Info: Redefining '\footcite'.
Package biblatex Info: Redefining '\footcitetext'.
Package biblatex Info: Redefining '\smartcite'.
Package biblatex Info: Redefining '\supercite'.
Package biblatex Info: Redefining '\textcite'.
Package biblatex Info: Redefining '\textcites'.
Package biblatex Info: Redefining '\cites'.
Package biblatex Info: Redefining '\parencites'.
Package biblatex Info: Redefining '\smartcites'.
)
Package biblatex Info: Trying to load configuration file...
Package biblatex Info: ... file 'biblatex.cfg' found.
(/usr/share/texlive/texmf-dist/tex/latex/biblatex/biblatex.cfg
File: biblatex.cfg
)
Package biblatex Warning: 'firstinits' option is deprecated.
(biblatex) Please use 'giveninits' instead.
Package biblatex Info: Input encoding 'utf8' detected.
Package biblatex Info: Document encoding is UTF8 ....
(/usr/share/texlive/texmf-dist/tex/latex/l3kernel/expl3.sty
Package: expl3 2023-01-16 L3 programming layer (loader)
(/usr/share/texlive/texmf-dist/tex/latex/l3backend/l3backend-pdftex.def
File: l3backend-pdftex.def 2023-01-16 L3 backend support: PDF output (pdfTeX)
\l__color_backend_stack_int=\count390
\l__pdf_internal_box=\box51
))
Package biblatex Info: ... and expl3
(biblatex) 2023-01-16 L3 programming layer (loader)
(biblatex) is new enough (at least 2020/04/06),
(biblatex) setting 'casechanger=expl3'.
(/usr/share/texlive/texmf-dist/tex/latex/biblatex/blx-case-expl3.sty
(/usr/share/texlive/texmf-dist/tex/latex/l3packages/xparse/xparse.sty
Package: xparse 2023-01-16 L3 Experimental document command parser
)
Package: blx-case-expl3 2022/07/12 v3.18b expl3 case changing code for biblatex
))
(/usr/share/texlive/texmf-dist/tex/latex/base/inputenc.sty
Package: inputenc 2021/02/14 v1.3d Input encoding file
\inpenc@prehook=\toks18
\inpenc@posthook=\toks19
)
(/usr/share/texlive/texmf-dist/tex/latex/base/fontenc.sty
Package: fontenc 2021/04/29 v2.0v Standard LaTeX package
)
(/usr/share/texlive/texmf-dist/tex/generic/babel/babel.sty
Package: babel 2022/12/26 3.84 The Babel package
\babel@savecnt=\count391
\U@D=\dimen149
\l@unhyphenated=\language88
(/usr/share/texlive/texmf-dist/tex/generic/babel/txtbabel.def)
\bbl@readstream=\read3
\bbl@dirlevel=\count392
(/usr/share/texlive/texmf-dist/tex/generic/babel-polish/polish.ldf
Language: polish 2022/03/12 1.3 Babel support for Polish
Package babel Info: Making " an active character on input line 101.
))
(/usr/share/texlive/texmf-dist/tex/generic/babel/locale/pl/babel-polish.tex
Package babel Info: Importing font and identification data for polish
(babel) from babel-pl.ini. Reported on input line 11.
)
(/usr/share/texlive/texmf-dist/tex/latex/listings/listings.sty
\lst@mode=\count393
\lst@gtempboxa=\box52
\lst@token=\toks20
\lst@length=\count394
\lst@currlwidth=\dimen150
\lst@column=\count395
\lst@pos=\count396
\lst@lostspace=\dimen151
\lst@width=\dimen152
\lst@newlines=\count397
\lst@lineno=\count398
\lst@maxwidth=\dimen153
(/usr/share/texlive/texmf-dist/tex/latex/listings/lstmisc.sty
File: lstmisc.sty 2020/03/24 1.8d (Carsten Heinz)
\c@lstnumber=\count399
\lst@skipnumbers=\count400
\lst@framebox=\box53
)
(/usr/share/texlive/texmf-dist/tex/latex/listings/listings.cfg
File: listings.cfg 2020/03/24 1.8d listings configuration
))
Package: listings 2020/03/24 1.8d (Carsten Heinz)
(/usr/share/texlive/texmf-dist/tex/latex/titlesec/titlesec.sty
Package: titlesec 2021/07/05 v2.14 Sectioning titles
\ttl@box=\box54
\beforetitleunit=\skip72
\aftertitleunit=\skip73
\ttl@plus=\dimen154
\ttl@minus=\dimen155
\ttl@toksa=\toks21
\titlewidth=\dimen156
\titlewidthlast=\dimen157
\titlewidthfirst=\dimen158
)
(/usr/share/texlive/texmf-dist/tex/latex/tocloft/tocloft.sty
Package: tocloft 2017/08/31 v2.3i parameterised ToC, etc., typesetting
Package tocloft Info: The document has chapter divisions on input line 51.
\cftparskip=\skip74
\cftbeforetoctitleskip=\skip75
\cftaftertoctitleskip=\skip76
\cftbeforepartskip=\skip77
\cftpartnumwidth=\skip78
\cftpartindent=\skip79
\cftbeforechapskip=\skip80
\cftchapindent=\skip81
\cftchapnumwidth=\skip82
\cftbeforesecskip=\skip83
\cftsecindent=\skip84
\cftsecnumwidth=\skip85
\cftbeforesubsecskip=\skip86
\cftsubsecindent=\skip87
\cftsubsecnumwidth=\skip88
\cftbeforesubsubsecskip=\skip89
\cftsubsubsecindent=\skip90
\cftsubsubsecnumwidth=\skip91
\cftbeforeparaskip=\skip92
\cftparaindent=\skip93
\cftparanumwidth=\skip94
\cftbeforesubparaskip=\skip95
\cftsubparaindent=\skip96
\cftsubparanumwidth=\skip97
\cftbeforeloftitleskip=\skip98
\cftafterloftitleskip=\skip99
\cftbeforefigskip=\skip100
\cftfigindent=\skip101
\cftfignumwidth=\skip102
\c@lofdepth=\count401
\c@lotdepth=\count402
\cftbeforelottitleskip=\skip103
\cftafterlottitleskip=\skip104
\cftbeforetabskip=\skip105
\cfttabindent=\skip106
\cfttabnumwidth=\skip107
)
(/usr/share/texlive/texmf-dist/tex/latex/enumitem/enumitem.sty
Package: enumitem 2019/06/20 v3.9 Customized lists
\labelindent=\skip108
\enit@outerparindent=\dimen159
\enit@toks=\toks22
\enit@inbox=\box55
\enit@count@id=\count403
\enitdp@description=\count404
)
\c@longenumi=\count405
\c@longenumii=\count406
\c@longenumiii=\count407
\c@longenumiv=\count408
\c@longenumv=\count409
\enitdp@longenum=\count410
(/usr/share/texlive/texmf-dist/tex/latex/fancyhdr/fancyhdr.sty
Package: fancyhdr 2022/11/09 v4.1 Extensive control of page headers and footers
\f@nch@headwidth=\skip109
\f@nch@O@elh=\skip110
\f@nch@O@erh=\skip111
\f@nch@O@olh=\skip112
\f@nch@O@orh=\skip113
\f@nch@O@elf=\skip114
\f@nch@O@erf=\skip115
\f@nch@O@olf=\skip116
\f@nch@O@orf=\skip117
)
(/usr/share/texlive/texmf-dist/tex/latex/eso-pic/eso-pic.sty
Package: eso-pic 2020/10/14 v3.0a eso-pic (RN)
\ESO@tempdima=\dimen160
\ESO@tempdimb=\dimen161
(/usr/share/texlive/texmf-dist/tex/latex/xcolor/xcolor.sty
Package: xcolor 2022/06/12 v2.14 LaTeX color extensions (UK)
(/usr/share/texlive/texmf-dist/tex/latex/graphics-cfg/color.cfg
File: color.cfg 2016/01/02 v1.6 sample color configuration
)
Package xcolor Info: Driver file: pdftex.def on input line 227.
(/usr/share/texlive/texmf-dist/tex/latex/graphics-def/pdftex.def
File: pdftex.def 2022/09/22 v1.2b Graphics/color driver for pdftex
)
(/usr/share/texlive/texmf-dist/tex/latex/graphics/mathcolor.ltx)
Package xcolor Info: Model `cmy' substituted by `cmy0' on input line 1353.
Package xcolor Info: Model `hsb' substituted by `rgb' on input line 1357.
Package xcolor Info: Model `RGB' extended on input line 1369.
Package xcolor Info: Model `HTML' substituted by `rgb' on input line 1371.
Package xcolor Info: Model `Hsb' substituted by `hsb' on input line 1372.
Package xcolor Info: Model `tHsb' substituted by `hsb' on input line 1373.
Package xcolor Info: Model `HSB' substituted by `hsb' on input line 1374.
Package xcolor Info: Model `Gray' substituted by `gray' on input line 1375.
Package xcolor Info: Model `wave' substituted by `hsb' on input line 1376.
))
(/usr/share/texlive/texmf-dist/tex/latex/graphics/graphicx.sty
Package: graphicx 2021/09/16 v1.2d Enhanced LaTeX Graphics (DPC,SPQR)
(/usr/share/texlive/texmf-dist/tex/latex/graphics/graphics.sty
Package: graphics 2022/03/10 v1.4e Standard LaTeX Graphics (DPC,SPQR)
(/usr/share/texlive/texmf-dist/tex/latex/graphics/trig.sty
Package: trig 2021/08/11 v1.11 sin cos tan (DPC)
)
(/usr/share/texlive/texmf-dist/tex/latex/graphics-cfg/graphics.cfg
File: graphics.cfg 2016/06/04 v1.11 sample graphics configuration
)
Package graphics Info: Driver file: pdftex.def on input line 107.
)
\Gin@req@height=\dimen162
\Gin@req@width=\dimen163
)
(/usr/share/texlive/texmf-dist/tex/latex/transparent/transparent.sty
Package: transparent 2022-10-27 v1.5 Transparency with color stacks
(/usr/share/texlive/texmf-dist/tex/latex/transparent/transparent-nometadata.sty
Package: transparent-nometadata 2022-10-27 v1.5 Transparency via pdfTeX's color
stack (HO)
(/usr/share/texlive/texmf-dist/tex/latex/auxhook/auxhook.sty
Package: auxhook 2019-12-17 v1.6 Hooks for auxiliary files (HO)
)))
(/usr/share/texlive/texmf-dist/tex/latex/datetime2/datetime2.sty
Package: datetime2 2021/03/21 v1.5.7 (NLCT) date and time formats
(/usr/share/texlive/texmf-dist/tex/latex/tracklang/tracklang.sty
Package: tracklang 2022/12/13 v1.6.1 (NLCT) Track Languages
(/usr/share/texlive/texmf-dist/tex/generic/tracklang/tracklang.tex))
(/usr/share/texlive/texmf-dist/tex/latex/xkeyval/xkeyval.sty
Package: xkeyval 2022/06/16 v2.9 package option processing (HA)
(/usr/share/texlive/texmf-dist/tex/generic/xkeyval/xkeyval.tex
(/usr/share/texlive/texmf-dist/tex/generic/xkeyval/xkvutils.tex
\XKV@toks=\toks23
\XKV@tempa@toks=\toks24
)
\XKV@depth=\count411
File: xkeyval.tex 2014/12/03 v2.7a key=value parser (HA)
))
(/usr/share/texlive/texmf-dist/tex/latex/datetime2-polish/datetime2-polish.ldf
File: datetime2-polish.ldf 2018/08/21 v1.1
(/usr/share/texlive/texmf-dist/tex/generic/iftex/ifxetex.sty
Package: ifxetex 2019/10/25 v0.7 ifxetex legacy package. Use iftex instead.
)
(/usr/share/texlive/texmf-dist/tex/generic/iftex/ifluatex.sty
Package: ifluatex 2019/10/25 v1.5 ifluatex legacy package. Use iftex instead.
)
(/usr/share/texlive/texmf-dist/tex/latex/datetime2-polish/datetime2-polish-asci
i.ldf
File: datetime2-polish-ascii.ldf 2018/08/21 v1.1
))) (/usr/share/texlive/texmf-dist/tex/generic/ulem/ulem.sty
\UL@box=\box56
\UL@hyphenbox=\box57
\UL@skip=\skip118
\UL@hook=\toks25
\UL@height=\dimen164
\UL@pe=\count412
\UL@pixel=\dimen165
\ULC@box=\box58
Package: ulem 2019/11/18
\ULdepth=\dimen166
)
(./commit.tex)
Package biblatex Warning: Load 'inputenc' before biblatex.
Package biblatex Warning: Missing 'hyperref' package.
(biblatex) Setting 'hyperref=false'.
Package biblatex Warning: 'babel/polyglossia' detected but 'csquotes' missing.
(biblatex) Loading 'csquotes' recommended.
\@quotelevel=\count413
\@quotereset=\count414
(./main.aux)
\openout1 = `main.aux'.
LaTeX Font Info: Checking defaults for OML/cmm/m/it on input line 139.
LaTeX Font Info: ... okay on input line 139.
LaTeX Font Info: Checking defaults for OMS/cmsy/m/n on input line 139.
LaTeX Font Info: ... okay on input line 139.
LaTeX Font Info: Checking defaults for OT1/cmr/m/n on input line 139.
LaTeX Font Info: ... okay on input line 139.
LaTeX Font Info: Checking defaults for T1/cmr/m/n on input line 139.
LaTeX Font Info: ... okay on input line 139.
LaTeX Font Info: Checking defaults for TS1/cmr/m/n on input line 139.
LaTeX Font Info: ... okay on input line 139.
LaTeX Font Info: Checking defaults for OMX/cmex/m/n on input line 139.
LaTeX Font Info: ... okay on input line 139.
LaTeX Font Info: Checking defaults for U/cmr/m/n on input line 139.
LaTeX Font Info: ... okay on input line 139.
*geometry* driver: auto-detecting
*geometry* detected driver: pdftex
*geometry* verbose mode - [ preamble ] result:
* driver: pdftex
* paper: a4paper
* layout: <same size as paper>
* layoutoffset:(h,v)=(0.0pt,0.0pt)
* modes:
* h-part:(L,W,R)=(73.97733pt, 449.55322pt, 73.97733pt)
* v-part:(T,H,B)=(73.97733pt, 697.0922pt, 73.97733pt)
* \paperwidth=597.50787pt
* \paperheight=845.04684pt
* \textwidth=449.55322pt
* \textheight=697.0922pt
* \oddsidemargin=1.70734pt
* \evensidemargin=1.70734pt
* \topmargin=-35.29266pt
* \headheight=12.0pt
* \headsep=25.0pt
* \topskip=10.0pt
* \footskip=30.0pt
* \marginparwidth=65.0pt
* \marginparsep=11.0pt
* \columnsep=10.0pt
* \skip\footins=9.0pt plus 4.0pt minus 2.0pt
* \hoffset=0.0pt
* \voffset=0.0pt
* \mag=1000
* \@twocolumnfalse
* \@twosidefalse
* \@mparswitchfalse
* \@reversemarginfalse
* (1in=72.27pt=25.4mm, 1cm=28.453pt)
Package biblatex Info: Trying to load language 'polish'...
Package biblatex Info: ... file 'polish.lbx' found.
(/usr/share/texlive/texmf-dist/tex/latex/biblatex/lbx/polish.lbx
File: polish.lbx 2022/07/12 v3.18b biblatex localization (PK/MW)
)
Package biblatex Info: Input encoding 'utf8' detected.
Package biblatex Info: Automatic encoding selection.
(biblatex) Assuming data encoding 'utf8'.
\openout3 = `main.bcf'.
Package biblatex Info: Trying to load bibliographic data...
Package biblatex Info: ... file 'main.bbl' not found.
No file main.bbl.
Package biblatex Info: Reference section=0 on input line 139.
Package biblatex Info: Reference segment=0 on input line 139.
\c@lstlisting=\count415
(/usr/share/texlive/texmf-dist/tex/context/base/mkii/supp-pdf.mkii
[Loading MPS to PDF converter (version 2006.09.02).]
\scratchcounter=\count416
\scratchdimen=\dimen167
\scratchbox=\box59
\nofMPsegments=\count417
\nofMParguments=\count418
\everyMPshowfont=\toks26
\MPscratchCnt=\count419
\MPscratchDim=\dimen168
\MPnumerator=\count420
\makeMPintoPDFobject=\count421
\everyMPtoPDFconversion=\toks27
) (/usr/share/texlive/texmf-dist/tex/latex/epstopdf-pkg/epstopdf-base.sty
Package: epstopdf-base 2020-01-24 v2.11 Base part for package epstopdf
Package epstopdf-base Info: Redefining graphics rule for `.eps' on input line 4
85.
(/usr/share/texlive/texmf-dist/tex/latex/latexconfig/epstopdf-sys.cfg
File: epstopdf-sys.cfg 2010/07/13 v1.3 Configuration of (r)epstopdf for TeX Liv
e
))
(./modules/crispr.tex
! LaTeX Error: Lonely \item--perhaps a missing list environment.
See the LaTeX manual or LaTeX Companion for explanation.
Type H <return> for immediate help.
...
l.2 \begin
{center}
?
Underfull \hbox (badness 10000) detected at line 2
[][]
[]
LaTeX Warning: Citation 'doudnaNewFrontierGenome2014' on page 1 undefined on in
put line 7.
LaTeX Font Info: External font `cmex10' loaded for size
(Font) <7> on input line 7.
LaTeX Font Info: External font `cmex10' loaded for size
(Font) <5> on input line 7.
LaTeX Warning: Citation 'jinekProgrammableDualRNAGuidedDNA2012' on page 1 undef
ined on input line 17.
LaTeX Warning: Citation 'jinekProgrammableDualRNAGuidedDNA2012' on page 1 undef
ined on input line 23.
LaTeX Warning: Citation 'montecilloCRISPRCas9SystemPlant2020' on page 1 undefin
ed on input line 41.
LaTeX Warning: Citation 'doudnaNewFrontierGenome2014' on page 1 undefined on in
put line 43.
)
LaTeX Font Info: Trying to load font information for T1+cmtt on input line 1
50.
(/usr/share/texlive/texmf-dist/tex/latex/base/t1cmtt.fd
File: t1cmtt.fd 2022/07/10 v2.5l Standard LaTeX font definitions
)
! Undefined control sequence.
\ESO@HookIIBG ->\BackgroundPic
l.150 \newpage
?
[1{/var/lib/texmf/fonts/map/pdftex/updmap/pdftex.map}
] (./modules/bio.tex
! LaTeX Error: Lonely \item--perhaps a missing list environment.
See the LaTeX manual or LaTeX Companion for explanation.
Type H <return> for immediate help.
...
l.3 \begin
{center}
?
Underfull \hbox (badness 10000) detected at line 3
[][]
[]
(/usr/share/texlive/texmf-dist/tex/latex/listings/lstlang1.sty
File: lstlang1.sty 2020/03/24 1.8d listings language file
)
(/usr/share/texlive/texmf-dist/tex/latex/listings/lstlang1.sty
File: lstlang1.sty 2020/03/24 1.8d listings language file
)
(/usr/share/texlive/texmf-dist/tex/latex/listings/lstlang1.sty
File: lstlang1.sty 2020/03/24 1.8d listings language file
) [2]) [3]
LaTeX Warning: Empty bibliography on input line 161.
(./main.aux)
LaTeX Warning: There were undefined references.
Package biblatex Warning: Please (re)run Biber on the file:
(biblatex) main
(biblatex) and rerun LaTeX afterwards.
Package logreq Info: Writing requests to 'main.run.xml'.
\openout1 = `main.run.xml'.
)
Here is how much of TeX's memory you used:
17843 strings out of 476091
331352 string characters out of 5794081
1989330 words of memory out of 5000000
38039 multiletter control sequences out of 15000+600000
518652 words of font info for 43 fonts, out of 8000000 for 9000
1141 hyphenation exceptions out of 8191
63i,11n,102p,673b,1626s stack positions out of 10000i,1000n,20000p,200000b,200000s
{/usr/share/texmf/fonts/enc/dvips/cm-super/cm-super-t1.enc}{/usr/share/texmf/
fonts/enc/dvips/cm-super/cm-super-ts1.enc}</usr/share/texmf/fonts/type1/public/
cm-super/sfbx1000.pfb></usr/share/texmf/fonts/type1/public/cm-super/sfbx1440.pf
b></usr/share/texmf/fonts/type1/public/cm-super/sfrm0500.pfb></usr/share/texmf/
fonts/type1/public/cm-super/sfrm1000.pfb></usr/share/texmf/fonts/type1/public/c
m-super/sfti1000.pfb></usr/share/texmf/fonts/type1/public/cm-super/sftt0800.pfb
></usr/share/texmf/fonts/type1/public/cm-super/sftt1000.pfb>
Output written on main.pdf (3 pages, 193812 bytes).
PDF statistics:
54 PDF objects out of 1000 (max. 8388607)
33 compressed objects within 1 object stream
0 named destinations out of 1000 (max. 500000)
1 words of extra memory for PDF output out of 10000 (max. 10000000)

BIN
doc/main.pdf Normal file

Binary file not shown.

85
doc/main.run.xml Normal file
View File

@ -0,0 +1,85 @@
<?xml version="1.0" standalone="yes"?>
<!-- logreq request file -->
<!-- logreq version 1.0 / dtd version 1.0 -->
<!-- Do not edit this file! -->
<!DOCTYPE requests [
<!ELEMENT requests (internal | external)*>
<!ELEMENT internal (generic, (provides | requires)*)>
<!ELEMENT external (generic, cmdline?, input?, output?, (provides | requires)*)>
<!ELEMENT cmdline (binary, (option | infile | outfile)*)>
<!ELEMENT input (file)+>
<!ELEMENT output (file)+>
<!ELEMENT provides (file)+>
<!ELEMENT requires (file)+>
<!ELEMENT generic (#PCDATA)>
<!ELEMENT binary (#PCDATA)>
<!ELEMENT option (#PCDATA)>
<!ELEMENT infile (#PCDATA)>
<!ELEMENT outfile (#PCDATA)>
<!ELEMENT file (#PCDATA)>
<!ATTLIST requests
version CDATA #REQUIRED
>
<!ATTLIST internal
package CDATA #REQUIRED
priority (9) #REQUIRED
active (0 | 1) #REQUIRED
>
<!ATTLIST external
package CDATA #REQUIRED
priority (1 | 2 | 3 | 4 | 5 | 6 | 7 | 8) #REQUIRED
active (0 | 1) #REQUIRED
>
<!ATTLIST provides
type (static | dynamic | editable) #REQUIRED
>
<!ATTLIST requires
type (static | dynamic | editable) #REQUIRED
>
<!ATTLIST file
type CDATA #IMPLIED
>
]>
<requests version="1.0">
<internal package="biblatex" priority="9" active="1">
<generic>latex</generic>
<provides type="dynamic">
<file>main.bcf</file>
</provides>
<requires type="dynamic">
<file>main.bbl</file>
</requires>
<requires type="static">
<file>blx-dm.def</file>
<file>blx-compat.def</file>
<file>biblatex.def</file>
<file>standard.bbx</file>
<file>numeric.bbx</file>
<file>numeric.cbx</file>
<file>biblatex.cfg</file>
<file>polish.lbx</file>
</requires>
</internal>
<external package="biblatex" priority="5" active="1">
<generic>biber</generic>
<cmdline>
<binary>biber</binary>
<infile>main</infile>
</cmdline>
<input>
<file>main.bcf</file>
</input>
<output>
<file>main.bbl</file>
</output>
<provides type="dynamic">
<file>main.bbl</file>
</provides>
<requires type="dynamic">
<file>main.bcf</file>
</requires>
<requires type="editable">
<file>references.bib</file>
</requires>
</external>
</requests>

164
doc/main.tex Normal file
View File

@ -0,0 +1,164 @@
\documentclass{report}
% Pakiety do ustawienia marginesów
\usepackage{geometry}
\geometry{
a4paper,
left=2.6cm,
right=2.6cm,
top=2.6cm,
bottom=2.6cm
}
\usepackage[
sortcites,
backend=biber,
hyperref=true,
firstinits=true,
maxbibnames=99,
]{biblatex}
\addbibresource{references.bib}
% Kodowanie i język
\usepackage[utf8]{inputenc} % Dla pdfLaTeX
\usepackage[T1]{fontenc}
\usepackage[polish]{babel}
\usepackage{listings}
% Pakiety do stylizacji
\usepackage{titlesec}
\usepackage{tocloft}
\usepackage{enumitem}
% \setlist[longenum,1]{label=\arabic*., nosep}
% \setlist[longenum,2]{label=\arabic*), nosep}
% \setlist[longenum,3]{label=\alph*., nosep}
\newlist{longenum}{enumerate}{5}
\setlist[longenum,1]{label=\arabic*., nosep}
\setlist[longenum,2]{label=\arabic*)}
\setlist[longenum,3]{label=\alph*.}
\setlist[longenum,4]{label=\alph*)}
\setlist[longenum,5]{label=--}
% Pakiet do nagłówków i stopek
\usepackage{fancyhdr}
\pagestyle{fancy}
\fancyhf{} % Czyszczenie domyślnych nagłówków i stopek
\fancyhead[L]{Biotech, PCz}
\fancyhead[R]{M. Pab.} % Lewy nagłówek
\fancyfoot[L]{Commit UUID: \texttt{\commitUUID} \\ Commit Date: \texttt{\commitDate}} % Lewa stopka - informacje linia po linii
\fancyfoot[R]{\thepage} % Prawa stopka - Numer strony
% Pakiety do dodawania znaków wodnych
\usepackage{eso-pic} % Pakiet do wstawiania znaków wodnych
\usepackage{graphicx} % Pakiet do wstawiania obrazów
\usepackage{transparent} % Pakiet do przezroczystości obrazów
% Pakiety dodatkowe
\usepackage{datetime2} % Pakiet do obsługi daty i godziny
\usepackage{ulem} % Pakiet do przekreślania tekstu
% Definicje kolorów
\usepackage{xcolor}
\definecolor{wzo}{rgb}{0.000, 0.502, 0.000} % intensywny zielony
\definecolor{szo}{rgb}{0.196, 0.803, 0.196} % limonkowy
\definecolor{pzo}{rgb}{0.235, 0.702, 0.443} % średni zielony
\definecolor{zoz}{rgb}{0.235, 0.702, 0.700} % średni zielony
\definecolor{stat}{rgb}{0.541, 0.169, 0.886} % fioletowy
\definecolor{kN}{rgb}{1.000, 0.647, 0.000} % pomarańczowy
\definecolor{uO}{rgb}{0.275, 0.514, 0.706} % niebieski
\definecolor{rO}{rgb}{0.0, 0.0, 0.5} % ciemno granatowy
\definecolor{uRODO}{rgb}{0.000, 0.502, 0.502} % teal
\definecolor{rRODO}{rgb}{0.125, 0.698, 0.667} % jasny teal
\definecolor{kor}{rgb}{1.0, 0.0, 0.0} % czerwony
\definecolor{zs}{rgb}{1.0, 0.0, 0.0} % Kolor Teal (lub dowolny wybrany kolor)
\definecolor{lightgray}{rgb}{0.70, 0.70, 0.70}
% Definicja kolorów
\definecolor{backcolour}{rgb}{0.95,0.95,0.92} % jasny szary
\definecolor{codegreen}{rgb}{0,0.6,0} % zielony
\definecolor{codegray}{rgb}{0.5,0.5,0.5} % szary
\definecolor{codepurple}{rgb}{0.58,0,0.82} % fioletowy
\definecolor{magentacolor}{rgb}{1.0, 0.0, 1.0} % magenta
% Styl dla kodu
\lstdefinestyle{mystyle}{
backgroundcolor=\color{backcolour},
commentstyle=\color{codegreen},
keywordstyle=\color{magentacolor},
numberstyle=\tiny\color{codegray},
stringstyle=\color{codepurple},
basicstyle=\ttfamily\footnotesize,
breaklines=true,
captionpos=b,
numbers=left,
numbersep=5pt,
showspaces=false,
showstringspaces=false,
showtabs=false,
tabsize=2,
extendedchars=true, % Umożliwia polskie znaki
literate={ą}{{\k{a}}}1 {ć}{{\'c}}1 {ę}{{\k{e}}}1 {ł}{{\l{}}}1 {ń}{{\'n}}1 {ó}{{\'o}}1 {ś}{{\'s}}1 {ż}{{\.z}}1 {ź}{{\'z}}1
}
% Ustawienie stylu jako domyślnego
\lstset{style=mystyle}
% Definicja nowej komendy \zs
\newcommand{\zs}{\textcolor{zs}{Zespół Szkół }}
% Wczytanie pliku z informacjami o commit
\input{commit.tex}
% Globalne ustawienie list
\setlist{leftmargin=*} % Usunięcie dodatkowego wcięcia dla wszystkich list
% Wyłączenie wcięcia akapitu
\setlength{\parindent}{0pt}
% % Definicja znaku wodnego
% \newcommand\BackgroundPic{
% \AtPageCenter{
% \makebox(0,0){
% \transparent{0.15} % Ustawienie przezroczystości na 10%
% \includegraphics[width=0.9\textwidth, keepaspectratio]{png/logo.png}
% }
% }
% }
\begin{document}
% Dodanie znaku wodnego do tła każdej strony
\AddToShipoutPictureBG*{\BackgroundPic}
% \begin{enumerate}[leftmargin=*]
\newpage
\input{modules/crispr}
\label{sec:crispr}
\newpage
\input{modules/bio}
\label{sec:bio}
% \newpage
% \input{modules/wymagania_edukacyjne} % Wczytaj zawartość pliku
% \label{sec:wymagania_edukacyjne}
% \end{enumerate}
\newpage
\printbibliography
\end{document}

110
doc/modules/bio.tex Normal file
View File

@ -0,0 +1,110 @@
\item
\begin{center}
\fbox{
\begin{minipage}{0.9\textwidth}
\textbf{Projektowanie systemu CRISPR do edycji genów Arabidopsis z użyciem Biopythona}
\end{minipage}
}
\end{center}
\vspace{1cm}
\textbf{Cel:}
\begin{itemize}
\item Nauczenie projektowania sekwencji gRNA do edycji genów.
\item Wykorzystanie Biopython do edycji genów odporności na suszę w \textit{Arabidopsis thaliana}.
\item Zaprojektowanie gRNA do wyciszenia lub modyfikacji genu.
\end{itemize}
\textbf{Wprowadzenie:}
\begin{itemize}
\item \textit{Arabidopsis thaliana} to modelowy organizm w badaniach roślinnych.
\item CRISPR umożliwia modyfikację genów związanych z odpornością na suszę.
\item W ćwiczeniu zaprojektujesz sekwencje gRNA do modyfikacji genów.
\end{itemize}
\section*{Krok 1: Przygotowanie środowiska}
\begin{itemize}
\item Zainstaluj Biopython:
\begin{lstlisting}[language=bash]
pip install biopython
\end{lstlisting}
\item Załaduj sekwencje genów \textit{Arabidopsis} do pliku \texttt{arabidopsis\_genes.fasta}.
\end{itemize}
\section*{Krok 2: Analiza sekwencji genów}
\begin{itemize}
\item Użyj Biopython do załadowania sekwencji genów.
\item Identyfikuj miejsca docelowe CRISPR w sekwencjach genów.
\end{itemize}
\textbf{Przykładowy kod:}
\begin{lstlisting}[language=Python]
from Bio import SeqIO
from Bio.Seq import Seq
# Załaduj sekwencje genów z pliku FASTA
def load_sequences(file_path):
return list(SeqIO.parse(file_path, "fasta"))
# Znajdź potencjalne sekwencje gRNA (20 nukleotydów + PAM "NGG")
def find_crispr_sites(sequence):
pam = "NGG"
sites = []
for i in range(len(sequence) - 23):
target = sequence[i:i+20]
pam_site = sequence[i+20:i+23]
if pam_site.endswith("GG"):
sites.append(target + pam_site)
return sites
# Przykład użycia
genes = load_sequences("arabidopsis_genes.fasta")
for gene in genes:
print(f"Gene ID: {gene.id}")
crispr_sites = find_crispr_sites(str(gene.seq))
print(f"Potential CRISPR sites: {crispr_sites[:5]}") # wyświetl tylko 5 pierwszych
\end{lstlisting}
\section*{Krok 3: Projektowanie sekwencji gRNA}
\begin{itemize}
\item Wyszukaj potencjalne sekwencje gRNA w sekwencjach genów.
\item Zidentyfikuj najbardziej odpowiednie miejsca do modyfikacji.
\end{itemize}
\section*{Krok 4: Analiza wydajności i specyficzności gRNA}
\begin{itemize}
\item Upewnij się, że gRNA nie ma niepożądanych miejsc docelowych w genomie.
\item Użyj dodatkowych algorytmów do oceny specyficzności.
\end{itemize}
\section*{Zadanie:}
\begin{itemize}
\item Znajdź potencjalne miejsca CRISPR w jednym z wybranych genów.
\item Wybierz najlepsze gRNA do edycji genu.
\item Zapisz wyniki w pliku \texttt{selected\_grnas.txt}.
\end{itemize}
\textbf{Przykład formatu pliku wynikowego:}
\begin{verbatim}
Gene ID: AT3G02990
Selected gRNA: ACTGACTGACTGACTGACTGGG (pos: 150-170)
\end{verbatim}
\section*{Dodatkowe wyzwania:}
\begin{itemize}
\item Zintegruj narzędzia Biopythona do analizy specyficzności gRNA w całym genomie \textit{Arabidopsis}.
\item Zaprojektuj gRNA do edycji wielu genów jednocześnie.
\end{itemize}
\section*{Podsumowanie:}
\begin{itemize}
\item Poznasz, jak używać narzędzi bioinformatycznych do projektowania gRNA.
\item Nauczysz się, jak zwiększać odporność roślin na stresy środowiskowe.
\end{itemize}
\section*{Referencje:}
\begin{itemize}
\item Biopython Tutorial and Cookbook
\item Zhang, H. et al. (2019). \textit{Genome editing in plants using CRISPR-Cas9}. Nature Reviews Genetics, 20(12), 769-788.
\end{itemize}

44
doc/modules/crispr.tex Normal file
View File

@ -0,0 +1,44 @@
\item
\begin{center}
\fbox{
\begin{minipage}{0.9\textwidth}
\textbf{CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)} to narzędzie do edycji genów. Umożliwia precyzyjne modyfikacje DNA. Zostało odkryte jako część systemu odpornościowego bakterii \cite{doudnaNewFrontierGenome2014}.
\end{minipage}
}
\end{center}
\vspace{1cm}
\textbf{Główne komponenty CRISPR:}
\begin{itemize}
\item \textbf{Białko Cas9:}
\begin{itemize}
\item Enzym, który przecina DNA.
\item Rozpoznaje specyficzne miejsca w genomie.
\item Działa jak molekularne nożyczki \cite{jinekProgrammableDualRNAGuidedDNA2012}.
\end{itemize}
\item \textbf{Przewodnik RNA (gRNA):}
\begin{itemize}
\item Krótki fragment RNA.
\item Prowadzi białko Cas9 do docelowego DNA.
\item Wiąże się z wybraną sekwencją DNA \cite{jinekProgrammableDualRNAGuidedDNA2012}.
\end{itemize}
\end{itemize}
\vspace{1cm}
\textbf{Zastosowania CRISPR:}
\begin{itemize}
\item Modyfikacja genów:
\begin{itemize}
\item Knock-out genów (wyłączenie funkcji genu).
\item Wprowadzenie mutacji.
\item Zmiana sekwencji DNA.
\end{itemize}
\end{itemize}
\vspace{1cm}
\textbf{Przykłady zastosowań:}
\begin{itemize}
\item Zwiększenie odporności roślin na suszę \cite{montecilloCRISPRCas9SystemPlant2020}.
\item Poprawa cech rolniczych zwierząt.
\item Terapia genowa u ludzi \cite{doudnaNewFrontierGenome2014}.
\end{itemize}

53
doc/references.bib Normal file
View File

@ -0,0 +1,53 @@
@article{doudnaNewFrontierGenome2014,
title = {The New Frontier of Genome Engineering with {{CRISPR-Cas9}}},
author = {Doudna, Jennifer A. and Charpentier, Emmanuelle},
date = {2014-11-28},
journaltitle = {Science},
shortjournal = {Science},
volume = {346},
number = {6213},
pages = {1258096},
issn = {0036-8075, 1095-9203},
doi = {10.1126/science.1258096},
url = {https://www.science.org/doi/10.1126/science.1258096},
urldate = {2024-10-22},
abstract = {The advent of facile genome engineering using the bacterial RNA-guided CRISPR-Cas9 system in animals and plants is transforming biology. We review the history of CRISPR (clustered regularly interspaced palindromic repeat) biology from its initial discovery through the elucidation of the CRISPR-Cas9 enzyme mechanism, which has set the stage for remarkable developments using this technology to modify, regulate, or mark genomic loci in a wide variety of cells and organisms from all three domains of life. These results highlight a new era in which genomic manipulation is no longer a bottleneck to experiments, paving the way toward fundamental discoveries in biology, with applications in all branches of biotechnology, as well as strategies for human therapeutics. , CRISPR-cas: A revolution in genome engineering The ability to engineer genomic DNA in cells and organisms easily and precisely will have major implications for basic biology research, medicine, and biotechnology. Doudna and Charpentier review the history of genome editing technologies, including oligonucleotide coupled to genome cleaving agents that rely on endogenous repair and recombination systems to complete the targeted changes, self-splicing introns, and zinc-finger nucleases and TAL effector nucleases. They then describe how clustered regularly interspaced palindromic repeats (CRISPRs), and their associated (Cas) nucleases, were discovered to constitute an adaptive immune system in bacteria. They document development of the CRISPR-Cas system into a facile genome engineering tool that is revolutionizing all areas of molecular biology. Science , this issue 10.1126/science.1258096},
langid = {english}
}
@article{jinekProgrammableDualRNAGuidedDNA2012,
title = {A {{Programmable Dual-RNA}}{{Guided DNA Endonuclease}} in {{Adaptive Bacterial Immunity}}},
author = {Jinek, Martin and Chylinski, Krzysztof and Fonfara, Ines and Hauer, Michael and Doudna, Jennifer A. and Charpentier, Emmanuelle},
date = {2012-08-17},
journaltitle = {Science},
shortjournal = {Science},
volume = {337},
number = {6096},
pages = {816--821},
issn = {0036-8075, 1095-9203},
doi = {10.1126/science.1225829},
url = {https://www.science.org/doi/10.1126/science.1225829},
urldate = {2024-10-22},
abstract = {Ditching Invading DNA Bacteria and archaea protect themselves from invasive foreign nucleic acids through an RNA-mediated adaptive immune system called CRISPR (clustered regularly interspaced short palindromic repeats)/CRISPR-associated (Cas). Jinek et al. (p. 816 , published online 28 June; see the Perspective by Brouns ) found that for the type II CRISPR/Cas system, the CRISPR RNA (crRNA) as well as the trans-activating crRNA—which is known to be involved in the pre-crRNA processing—were both required to direct the Cas9 endonuclease to cleave the invading target DNA. Furthermore, engineered RNA molecules were able to program the Cas9 endonuclease to cleave specific DNA sequences to generate double-stranded DNA breaks. , A prokaryotic RNAdirected targeting system can be designed to cleave any DNA sequence. , Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) systems provide bacteria and archaea with adaptive immunity against viruses and plasmids by using CRISPR RNAs (crRNAs) to guide the silencing of invading nucleic acids. We show here that in a subset of these systems, the mature crRNA that is base-paired to trans-activating crRNA (tracrRNA) forms a two-RNA structure that directs the CRISPR-associated protein Cas9 to introduce double-stranded (ds) breaks in target DNA. At sites complementary to the crRNA-guide sequence, the Cas9 HNH nuclease domain cleaves the complementary strand, whereas the Cas9 RuvC-like domain cleaves the noncomplementary strand. The dual-tracrRNA:crRNA, when engineered as a single RNA chimera, also directs sequence-specific Cas9 dsDNA cleavage. Our study reveals a family of endonucleases that use dual-RNAs for site-specific DNA cleavage and highlights the potential to exploit the system for RNA-programmable genome editing.},
langid = {english},
file = {/home/user/Zotero/storage/7LCA9MTW/Jinek et al. - 2012 - A Programmable Dual-RNAGuided DNA Endonuclease in Adaptive Bacterial Immunity.pdf}
}
@article{montecilloCRISPRCas9SystemPlant2020,
title = {{{CRISPR-Cas9 System}} for {{Plant Genome Editing}}: {{Current Approaches}} and {{Emerging Developments}}},
shorttitle = {{{CRISPR-Cas9 System}} for {{Plant Genome Editing}}},
author = {Montecillo, Jake Adolf V. and Chu, Luan Luong and Bae, Hanhong},
date = {2020-07-17},
journaltitle = {Agronomy},
shortjournal = {Agronomy},
volume = {10},
number = {7},
pages = {1033},
issn = {2073-4395},
doi = {10.3390/agronomy10071033},
url = {https://www.mdpi.com/2073-4395/10/7/1033},
urldate = {2024-10-22},
abstract = {Targeted genome editing using CRISPR-Cas9 has been widely adopted as a genetic engineering tool in various biological systems. This editing technology has been in the limelight due to its simplicity and versatility compared to other previously known genome editing platforms. Several modifications of this editing system have been established for adoption in a variety of plants, as well as for its improved efficiency and portability, bringing new opportunities for the development of transgene-free improved varieties of economically important crops. This review presents an overview of CRISPR-Cas9 and its application in plant genome editing. A catalog of the current and emerging approaches for the implementation of the system in plants is also presented with details on the existing gaps and limitations. Strategies for the establishment of the CRISPR-Cas9 molecular construct such as the selection of sgRNAs, PAM compatibility, choice of promoters, vector architecture, and multiplexing approaches are emphasized. Progress in the delivery and transgene detection methods, together with optimization approaches for improved on-target efficiency are also detailed in this review. The information laid out here will provide options useful for the effective and efficient exploitation of the system for plant genome editing and will serve as a baseline for further developments of the system. Future combinations and fine-tuning of the known parameters or factors that contribute to the editing efficiency, fidelity, and portability of CRISPR-Cas9 will indeed open avenues for new technological advancements of the system for targeted gene editing in plants.},
langid = {english},
file = {/home/user/Zotero/storage/JJPA5C9W/Montecillo et al. - 2020 - CRISPR-Cas9 System for Plant Genome Editing Current Approaches and Emerging Developments.pdf}
}

32
py/0.py Normal file
View File

@ -0,0 +1,32 @@
from Bio import Entrez, SeqIO
# Ustaw swój adres e-mail (wymagany przez NCBI)
Entrez.email = "your_email@example.com"
def download_genome(genome_id, file_name):
"""
Pobierz sekwencję genomu z NCBI i zapisz jako plik FASTA.
Parameters:
genome_id (str): ID genomu w bazie NCBI.
file_name (str): Nazwa pliku, do którego zostanie zapisana sekwencja.
"""
try:
# Pobierz rekord z bazy danych NCBI
with Entrez.efetch(db="nucleotide", id=genome_id, rettype="fasta", retmode="text") as handle:
genome_seq = SeqIO.read(handle, "fasta")
# Zapisz rekord do pliku FASTA
with open(file_name, "w") as output_handle:
SeqIO.write(genome_seq, output_handle, "fasta")
print(f"Genom zapisany do pliku: {file_name}")
except Exception as e:
print(f"Wystąpił błąd: {e}")
# Przykład użycia
genome_id = "NC_000932" # Przykładowe ID genomu (np. Arabidopsis thaliana chloroplast)
file_name = "arabidopsis_genome.fasta"
download_genome(genome_id, file_name)

24
py/1.py Normal file
View File

@ -0,0 +1,24 @@
from Bio import SeqIO
from Bio.Seq import Seq
# Załaduj sekwencje genów z pliku FASTA
def load_sequences(file_path):
return list(SeqIO.parse(file_path, "fasta"))
# Znajdź potencjalne sekwencje gRNA (20 nukleotydów + PAM "NGG")
def find_crispr_sites(sequence):
pam = "NGG"
sites = []
for i in range(len(sequence) - 23):
target = sequence[i:i+20]
pam_site = sequence[i+20:i+23]
if pam_site.endswith("GG"):
sites.append(target + pam_site)
return sites
# Przykład użycia
genes = load_sequences("arabidopsis_genome.fasta")
for gene in genes:
print(f"Gene ID: {gene.id}")
crispr_sites = find_crispr_sites(str(gene.seq))
print(f"Potential CRISPR sites: {crispr_sites[:5]}") # wyświetl tylko 5 pierwszych

47
py/2.py Normal file
View File

@ -0,0 +1,47 @@
def print_crispr_target(gene_sequence, gRNA, pam, gRNA_position):
# Długości sekwencji gRNA i PAM
gRNA_length = len(gRNA)
pam_length = len(pam)
# Zbuduj schemat tekstowy
dna_display = list(gene_sequence)
gRNA_end = gRNA_position + gRNA_length
pam_start = gRNA_end
pam_end = pam_start + pam_length
# Upewnij się, że PAM mieści się w sekwencji DNA
if pam_end > len(gene_sequence):
print("Error: PAM nie mieści się w sekwencji DNA. Sprawdź pozycję gRNA i długość sekwencji.")
return
# Oznaczenie gRNA w konsoli
for i in range(gRNA_position, gRNA_end):
dna_display[i] = dna_display[i].lower() # Zaznacz gRNA (małe litery)
# Oznaczenie PAM w konsoli
for i in range(pam_start, pam_end):
dna_display[i] = dna_display[i].upper() # Zaznacz PAM (wielkie litery)
# Utwórz linię z końcami 5' i 3'
sequence_line = ''.join(dna_display)
# Generuj znaczniki dla orientacji gRNA i PAM
marker_line = ' ' * gRNA_position + '^' * gRNA_length + ' ' * (pam_start - gRNA_end) + 'PAM'
# Wyświetl wyniki
print("Sense Strand (5' to 3'):")
print(f"5' {sequence_line} 3'")
print(f" {marker_line}")
print("\nComplementary Strand (3' to 5'):")
complement = gene_sequence.translate(str.maketrans("ATGC", "TACG"))[::-1]
print(f"3' {complement} 5'")
# Przykładowe dane
gene_sequence = "ATGCGGCTAGCGACGGGAATTGAACCCGCGATGG"
gRNA = "GACGGGAATTGAACCCGCGA" # 20 nt
pam = "TGG" # PAM (NGG)
gRNA_position = 12 # Gdzie w sekwencji zaczyna się gRNA
# Wywołanie funkcji
print_crispr_target(gene_sequence, gRNA, pam, gRNA_position)

68
py/3.py Normal file
View File

@ -0,0 +1,68 @@
from Bio import Entrez, SeqIO
from Bio.Seq import Seq
# Ustaw swój adres e-mail (wymagany przez NCBI)
Entrez.email = "your_email@example.com"
# Funkcja do pobierania szczegółów genu
def get_gene_info(gene_id):
try:
# Pobierz adnotacje genowe z NCBI
handle = Entrez.efetch(db="gene", id=gene_id, retmode="xml")
records = Entrez.read(handle)
# Wyciągnij podstawowe informacje
gene_name = records[0]["Entrezgene_gene"]["Gene-ref"]["Gene-ref_locus"]
summary = records[0]["Entrezgene_summary"]
chromosome = records[0]["Entrezgene_source"]["BioSource"]["BioSource_subtype"][0]["SubSource_name"]
exon_count = len(records[0]["Entrezgene_locus"][0]["Gene-commentary_seqs"])
# Wyświetl podstawowe informacje o genie
print(f"Nazwa genu: {gene_name}")
print(f"Opis: {summary}")
print(f"Chromosom: {chromosome}")
print(f"Liczba eksonów: {exon_count}")
except Exception as e:
print(f"Wystąpił błąd podczas pobierania informacji o genie: {e}")
# Funkcja do załadowania sekwencji genów z pliku FASTA
def load_sequences(file_path):
return list(SeqIO.parse(file_path, "fasta"))
# Znajdź potencjalne sekwencje gRNA (20 nukleotydów + PAM "NGG") w określonym regionie
def find_crispr_sites_in_region(sequence, start, end):
pam = "NGG"
sites = []
# Ogranicz przeszukiwanie do wybranego regionu
target_region = sequence[start:end]
for i in range(len(target_region) - 23):
target = target_region[i:i+20]
pam_site = target_region[i+20:i+23]
if pam_site.endswith("GG"):
# Zapisz pełną sekwencję wraz z lokalizacją w genomie
sites.append((start + i, target + pam_site))
return sites
# Przykład użycia
gene_id = "835067" # Przykładowe ID genu (należy zastąpić rzeczywistym ID odpornego na suszę genu)
get_gene_info(gene_id)
# Zakładamy, że sekwencja DNA jest już wczytana do pliku FASTA
genes = load_sequences("arabidopsis_genome.fasta")
# Przykładowe pozycje startowe i końcowe genu odpowiedzialnego za odporność na suszę
start_position = 1000 # przykładowa pozycja początkowa
end_position = 2000 # przykładowa pozycja końcowa
for gene in genes:
print(f"\nGene ID: {gene.id}")
crispr_sites = find_crispr_sites_in_region(str(gene.seq), start_position, end_position)
# Wyświetl tylko 5 pierwszych wyników, wraz z ich pozycją w sekwencji DNA
for pos, site in crispr_sites[:5]:
print(f"Position: {pos}, CRISPR site: {site}")

83
py/4.py Normal file
View File

@ -0,0 +1,83 @@
from Bio import Entrez, SeqIO
from Bio.Seq import Seq
from termcolor import colored
# Ustaw swój adres e-mail (wymagany przez NCBI)
Entrez.email = "baiobelfer@gmail.com"
# Funkcja do pobierania szczegółów genu
def get_gene_info(gene_id):
try:
# Pobierz adnotacje genowe z NCBI
handle = Entrez.efetch(db="gene", id=gene_id, retmode="xml")
records = Entrez.read(handle)
# Wyciągnij podstawowe informacje
gene_ref = records[0]["Entrezgene_gene"]["Gene-ref"]
gene_name = gene_ref.get("Gene-ref_locus", "Brak danych")
summary = records[0].get("Entrezgene_summary", "Brak opisu")
chromosome = "Brak danych"
if "BioSource" in records[0]["Entrezgene_source"]:
chromosome_data = records[0]["Entrezgene_source"]["BioSource"]["BioSource_subtype"]
if chromosome_data:
chromosome = chromosome_data[0].get("SubSource_name", "Brak danych")
exon_count = len(records[0].get("Entrezgene_locus", []))
# Wyświetl podstawowe informacje o genie
print(f"Nazwa genu: {gene_name}")
print(f"Opis: {summary}")
print(f"Chromosom: {chromosome}")
print(f"Liczba eksonów: {exon_count}")
except Exception as e:
print(f"Wystąpił błąd podczas pobierania informacji o genie: {e}")
# Funkcja do załadowania sekwencji genów z pliku FASTA
def load_sequences(file_path):
return list(SeqIO.parse(file_path, "fasta"))
# Znajdź potencjalne sekwencje gRNA (20 nukleotydów + PAM "NGG") w określonym regionie
def find_crispr_sites_in_region(sequence, start, end):
pam = "NGG"
sites = []
# Ogranicz przeszukiwanie do wybranego regionu
target_region = sequence[start:end]
for i in range(len(target_region) - 23):
target = target_region[i:i+20]
pam_site = target_region[i+20:i+23]
if pam_site.endswith("GG"):
# Zapisz pełną sekwencję wraz z lokalizacją w genomie
sites.append((start + i, target + pam_site))
return sites
# Funkcja do kolorowania wyjścia
def print_colored_crispr_sites(sites):
for pos, site in sites:
gRNA = colored(site[:20], 'blue') # Sekwencja gRNA na niebiesko
pam = colored(site[20:], 'red', attrs=['bold']) # PAM na czerwono i pogrubione
print(f"Position: {pos}, CRISPR site: {gRNA}{pam}")
# Przykład użycia
# Zmieniamy na ID genu "DREB2A" odpowiedzialnego za odporność na suszę w Arabidopsis
gene_id = "355350790" # Przykładowe ID genu DREB2A z NCBI
get_gene_info(gene_id)
# Zakładamy, że sekwencja DNA jest już wczytana do pliku FASTA
genes = load_sequences("arabidopsis_genome.fasta")
# Przykładowe pozycje startowe i końcowe genu odpowiedzialnego za odporność na suszę
start_position = 1000 # przykładowa pozycja początkowa
end_position = 2000 # przykładowa pozycja końcowa
for gene in genes:
print(f"\nGene ID: {gene.id}")
crispr_sites = find_crispr_sites_in_region(str(gene.seq), start_position, end_position)
# Wyświetl tylko 5 pierwszych wyników, wraz z ich pozycją w sekwencji DNA i kolorowaniem
print_colored_crispr_sites(crispr_sites[:5])

File diff suppressed because it is too large Load Diff