diff --git a/gfp2.py b/gfp2.py
index 836974c..845de8f 100644
--- a/gfp2.py
+++ b/gfp2.py
@@ -85,7 +85,7 @@ for feature in record.features:
# Przejdź przez wszystkie funkcje w rekordzie i wypisz ich szczegółowe informacje
for feature in record.features:
- if feature.type in ["promoter", "RBS","CDS", "protein_bind", "misc_feature", "rep_origin"]:
+ if feature.type in ["promoter", "RBS","CDS", "protein_bind", "misc_feature", "rep_origin", "terminator"]:
print(f"Type: {feature.type}")
print(f"Location: {feature.location}")
print(f"Strand: {'+' if feature.strand == 1 else '-'}")
@@ -156,20 +156,19 @@ t=record[25:73].seq
#%%
a = str (t)
-
+a
#%%
class Model:
+
+ complement = {'A': 'T', 'T': 'A', 'C': 'G', 'G': 'C'}
+
def __init__ (self, seq=None):
self.seq = seq
def complement_dna(self):
- # Tworzenie słownika komplementarnych zasad
- complement = {'A': 'T', 'T': 'A', 'C': 'G', 'G': 'C'}
-
- # Tworzenie komplementarnej sekwencji
+
complementary_sequence = ''.join(complement[base] for base in self.seq)
-
return complementary_sequence
#%%
@@ -184,6 +183,16 @@ r.seq[::-1]
#%%
r.complement_dna()
+#%%
+r.seq
+#%%
+complement = {'A': 'T', 'T': 'A', 'C': 'G', 'G': 'C'}
+complementary_sequence = ''.join(complement[base] for base in r.seq)
+complementary_sequence
+
+#%%
+
+
#%%
# Sekwencja DNA
dna_seq = record.seq
diff --git a/index.html b/index.html
new file mode 100644
index 0000000..ba6e1ad
--- /dev/null
+++ b/index.html
@@ -0,0 +1,10 @@
+
+
+
+
+ Index
+
+
+
+
+
diff --git a/js.js b/js.js
new file mode 100644
index 0000000..16a60fe
--- /dev/null
+++ b/js.js
@@ -0,0 +1,36 @@
+/*
+ * js.js
+ * Copyright (C) 2024 user
+ *
+ * Distributed under terms of the MIT license.
+ */
+(function(){
+ 'use strict';
+
+// Assuming t is obtained from some source and contains the sequence
+let t = 'CAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAG'
+
+let a = String(t);
+console.log(a);
+
+class Model {
+ static complement = {'A': 'T', 'T': 'A', 'C': 'G', 'G': 'C'};
+
+ constructor(seq = null) {
+ this.seq = seq;
+ }
+
+ complement_dna() {
+ let complementary_sequence = '';
+ for (let base of this.seq) {
+ complementary_sequence += Model.complement[base];
+ }
+ return complementary_sequence;
+ }
+}
+
+// Example usage:
+let model = new Model(a);
+console.log(model.complement_dna());
+
+})();